ID: 998134113

View in Genome Browser
Species Human (GRCh38)
Location 5:139665754-139665776
Sequence CAAGCTGGGCAGAGGGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998134105_998134113 2 Left 998134105 5:139665729-139665751 CCACTGGAGACGTGCAGCTTCCG 0: 1
1: 0
2: 0
3: 10
4: 78
Right 998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG 0: 1
1: 0
2: 2
3: 46
4: 330
998134102_998134113 28 Left 998134102 5:139665703-139665725 CCAGTCTTGCTGACGTCAGTGCT 0: 1
1: 0
2: 2
3: 9
4: 118
Right 998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG 0: 1
1: 0
2: 2
3: 46
4: 330
998134104_998134113 3 Left 998134104 5:139665728-139665750 CCCACTGGAGACGTGCAGCTTCC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG 0: 1
1: 0
2: 2
3: 46
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998134113 Original CRISPR CAAGCTGGGCAGAGGGACCC CGG Intronic
900142112 1:1143065-1143087 CCAGCTGGGCTGAGCCACCCCGG + Intergenic
900510016 1:3054340-3054362 CAAGGTGGGGACAGTGACCCAGG + Intergenic
900968717 1:5977315-5977337 CAAGCAGAGCAGGGAGACCCAGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902219606 1:14956720-14956742 CAAGCAGGGAAGAGGGGCCCTGG + Intronic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
902232407 1:15036330-15036352 CAGGCAGGGCAGGGGGAGCCGGG - Intronic
902697317 1:18149156-18149178 CAGGCTGGACAGAGGGGCTCAGG - Intronic
902891931 1:19450679-19450701 GAAGCTGGGCACAAGGCCCCAGG + Intronic
903238042 1:21963540-21963562 CAACCAGAGCAGAGGGTCCCTGG + Intergenic
903261965 1:22136379-22136401 CCTGCTGGGCTGAGGGAACCTGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903968847 1:27106217-27106239 CACTCTGGGCTGAGGGACCCAGG - Intronic
904743289 1:32695113-32695135 CAAACTGGGCAGAGAGTCGCCGG + Exonic
904921426 1:34011128-34011150 CAAGCTGGGCTGGGGGCTCCAGG + Intronic
905455420 1:38084909-38084931 CAAGCTGTGCCCAGGGACTCTGG + Intergenic
907091891 1:51732811-51732833 CATGCTGGGCAGCTGGACTCTGG - Intronic
907158631 1:52355912-52355934 CCAGCTGGGCAGACAGGCCCTGG - Intronic
907305934 1:53513228-53513250 CAGGCTGGGGAGGGGGAGCCCGG - Intronic
907452027 1:54551603-54551625 GAGGCTGGGCAGAGGTTCCCAGG - Intronic
907452936 1:54558913-54558935 CACGCTGGGCTCAGCGACCCAGG + Intronic
907472199 1:54681088-54681110 CAGGCCAGGCAGAGGCACCCAGG + Intronic
909717998 1:78733457-78733479 CATGCTTGGCAGAGGAACTCAGG - Intergenic
910491073 1:87771854-87771876 CAAGCCAGGAAGAGGGCCCCAGG - Intergenic
911123591 1:94319801-94319823 AAGGGTGGGCAGAGTGACCCTGG - Intergenic
911449474 1:98045666-98045688 GAAGCTGGGCAGAGGGTCGCTGG - Intergenic
912430694 1:109626976-109626998 CAGGCAGGGCAGAGGTGCCCAGG - Intronic
912709987 1:111943260-111943282 CAAATAGGGCAGAGGGGCCCTGG + Intronic
916744242 1:167671983-167672005 CAACCTGGCCAGAGGCACCCGGG - Intronic
917418117 1:174832753-174832775 CAAGCTGGAGAAAGGGACCTGGG - Intronic
920216245 1:204363236-204363258 CAGGCTGGGCAGTGAGACCCCGG - Intronic
920937487 1:210449159-210449181 CAGACATGGCAGAGGGACCCGGG - Intronic
921128001 1:212195335-212195357 CATGCAGGGCAGTGGGGCCCTGG - Intergenic
921181697 1:212636590-212636612 CAAGCTGGAAGGAGGGACCCTGG - Intergenic
921940180 1:220830938-220830960 CAAGCTGGAGAGAGGGAGGCTGG - Intergenic
922771073 1:228183281-228183303 AAAGTTGGGCAGAGGGAACAAGG - Intergenic
922987588 1:229877923-229877945 CAAGCAGGGCAGAGAGAGCAGGG - Intergenic
923079973 1:230643913-230643935 CATGCTGGGGAGAGGTGCCCTGG + Intronic
923190093 1:231611927-231611949 CCAGCTGGGCACAGGGAGCTGGG + Intronic
923338840 1:232991248-232991270 CAAGCCTGGGAGAGGGACACTGG + Intronic
924801188 1:247330790-247330812 CAAGGTGGGAAGGGGGACTCGGG + Intronic
1066460497 10:35608425-35608447 AAAGCTGGGCAGACAGCCCCGGG + Exonic
1070056388 10:72939074-72939096 CAAGCTGGGCAGGGGGAGTTTGG + Intronic
1070656808 10:78277276-78277298 CAGGCAGAGCAGAGGCACCCAGG - Intergenic
1070748039 10:78946878-78946900 CAAGCTGGGCATAGTGGCCCAGG + Intergenic
1070756861 10:78998663-78998685 AAAGCTGGCCTGAGGGGCCCAGG + Intergenic
1073056517 10:100706792-100706814 CCAGCTGGGCTGAGGGACTTTGG - Intergenic
1075121623 10:119668836-119668858 CAAGATAGGCACAGGGACCACGG + Intronic
1075314557 10:121442280-121442302 CAAGCTGAGCAGGGGGCCCAGGG + Intergenic
1075438187 10:122460487-122460509 CACCCTGGGCAGAGGCACCCAGG - Intergenic
1075845746 10:125544041-125544063 GAAACAGGGCAGAGGGACCAGGG - Intergenic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1076783849 10:132739341-132739363 TGAGCTTGGCAGAGGGACCCCGG - Intronic
1077288870 11:1779698-1779720 CAAGCTGGGCAGACGGAAAGGGG + Intergenic
1077390777 11:2299908-2299930 CAAGCTGGCCTAAGGGCCCCTGG - Intronic
1078348632 11:10573961-10573983 AGAGCAGGGCAGAGGGACTCTGG - Exonic
1081964872 11:47163426-47163448 AAGGATGGGCAGAGGGAGCCAGG - Intronic
1082774851 11:57237020-57237042 GAAGACGGGCAGAGGGTCCCAGG + Exonic
1083621755 11:64052808-64052830 CCACCTGGGCAAAGGGCCCCTGG - Intronic
1083712646 11:64558716-64558738 CAAGGTGGGCAGTGGGAGGCAGG - Intronic
1083881768 11:65552452-65552474 GCAGCTGGGCAGAGGGACGTGGG - Intronic
1083888852 11:65585746-65585768 CTATCTGATCAGAGGGACCCTGG + Intronic
1083923000 11:65790423-65790445 CAGGCTGGGCGGTGGGACACTGG + Intronic
1083962107 11:66020386-66020408 CAGGCTGGGGAGAGGGACAGGGG + Exonic
1083988565 11:66232816-66232838 GAAGCTGGGCAAAGGCAGCCAGG - Intronic
1085741756 11:79083213-79083235 CAAGATGGGGACAGGGATCCAGG + Intronic
1088911901 11:114198523-114198545 GAAGGTGGCCAGAGGGGCCCTGG - Intronic
1089394763 11:118129348-118129370 AAGGCTGGGGAGAGGGCCCCAGG - Intergenic
1089667407 11:120029282-120029304 CAAGCTTGTCTGAGGGAACCAGG + Intergenic
1089743632 11:120602041-120602063 TGAGCTGGGGAGAGGGACTCTGG - Intronic
1090263295 11:125338186-125338208 GAAGATGGGCAGAGGGAGACAGG - Intronic
1090550273 11:127811666-127811688 CAAGCTGGACAAAATGACCCTGG + Intergenic
1091675857 12:2488768-2488790 CCTGCTGGGAAGAGGGGCCCAGG + Intronic
1092493947 12:8973024-8973046 CCAGCTGGGCTGAGGGAGGCTGG + Intronic
1097195933 12:57242528-57242550 CAAGGTTGGCAGCGGGAGCCCGG - Intergenic
1097686049 12:62691844-62691866 CCAGCAGGGCAGAGGGCCCCAGG - Intronic
1100477968 12:94951466-94951488 CAAGCTGGGGTGTGGGCCCCAGG + Intronic
1101137250 12:101756966-101756988 CAAGCTGTTCAGAGAGACCCAGG - Intronic
1101175974 12:102151867-102151889 CAAGCTGAGAAGAAGGAACCAGG + Intronic
1102006628 12:109593215-109593237 CAGGCTGGTGAGAGGCACCCGGG + Intronic
1103926650 12:124427134-124427156 CCAGCTGGGCCCAGGGAGCCCGG + Intronic
1104629730 12:130390497-130390519 AAACCTGGGCTGAGGGACCCCGG - Intergenic
1104919991 12:132285708-132285730 GAAGCTGGGCTGAGGCACCATGG - Intronic
1104992578 12:132634463-132634485 CAAACGGGGCAGATGGACCCAGG - Intronic
1105754358 13:23451356-23451378 CAAGCTGTGCAGGGCCACCCGGG - Intergenic
1106402475 13:29443554-29443576 AAAGCTGGGCTGAAGGAACCAGG - Intronic
1112247294 13:97746746-97746768 CGATCTTGGCAGATGGACCCAGG - Intergenic
1112261768 13:97884049-97884071 CAAGCAGGGGAGAGGGAGACGGG + Intergenic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1117677195 14:58166943-58166965 CAAGCTGGGGAGATGTATCCTGG - Intronic
1117688447 14:58279938-58279960 CTAGGTAGGAAGAGGGACCCAGG + Intronic
1119736233 14:76984608-76984630 CCAGTTGAGCAAAGGGACCCTGG - Intergenic
1120700996 14:87698652-87698674 GCAGCTGGGCAGAAGGAGCCTGG - Intergenic
1120707115 14:87756541-87756563 AAAACTGAGCAGAGGGATCCAGG + Intergenic
1121577314 14:94998816-94998838 CAAGCTGGGCAGAAATGCCCAGG + Intergenic
1122929309 14:104926118-104926140 CAGGCTGGGCGCTGGGACCCAGG - Intronic
1123037778 14:105478431-105478453 CATGCTGCGCAGAGGGGCGCGGG - Exonic
1124170272 15:27366821-27366843 CAAGGTGGGCAGGGGGACACGGG - Intronic
1125727813 15:41877018-41877040 CAGGCTGGGCAGGAGGCCCCTGG - Intronic
1129170941 15:73807464-73807486 CCAGCAGGGCAGAGGGAACATGG - Intergenic
1129383156 15:75180546-75180568 AAAGCTGGGCAGAGGGTTCTGGG + Intergenic
1129464293 15:75715268-75715290 CTAGCTGGGCAGAGAAACACAGG + Intergenic
1129720956 15:77877744-77877766 CTAGCTGGGCAGAGAAACACAGG - Intergenic
1130658723 15:85812914-85812936 CAAGCTGGGCAGAGTAGGCCTGG - Intergenic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1132864222 16:2085685-2085707 CAAGCTGGGCAGGGTGCGCCCGG - Intronic
1133738202 16:8631603-8631625 CAAGCTGGGAGGAGGGAGACTGG + Intronic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134448526 16:14348727-14348749 GAAGCTGGGCGAAGGGACACAGG - Intergenic
1135207457 16:20495022-20495044 AGAGCTGGGGAGAGGAACCCTGG - Intergenic
1135211428 16:20528610-20528632 AGAGCTGGGGAGAGGAACCCTGG + Intergenic
1136708264 16:32209221-32209243 CAGGCCTGGCAGAGGGTCCCTGG - Intergenic
1138605556 16:58086187-58086209 CAGGCTGCTCAGAGGGACTCAGG - Intergenic
1139302749 16:65959327-65959349 CAAGGCAGGCAAAGGGACCCAGG + Intergenic
1139374358 16:66487544-66487566 CTGGCTGGGCAGAGGGTCCCAGG - Intronic
1139847100 16:69929019-69929041 CATGCAGTGCAGAGGGTCCCAGG + Intronic
1141764843 16:86051577-86051599 CGCGCTGGGGAGAGGGTCCCTGG + Intergenic
1141831782 16:86513116-86513138 CAGGCGGGTCACAGGGACCCTGG + Exonic
1141934922 16:87231510-87231532 GAAGCTGGGGAGAGGCACACTGG - Intronic
1142016384 16:87750363-87750385 GAAGCTGGGCTGCGTGACCCTGG - Intronic
1143095645 17:4477025-4477047 CGAGATGGGCAGGGGGCCCCTGG - Intronic
1143125867 17:4640641-4640663 AAAGCGGGGCAAAGGGAGCCAGG - Intronic
1143964965 17:10750508-10750530 CAAGTTGTGTAGAGGGAACCAGG - Intergenic
1147165251 17:38589691-38589713 GAAGCTGGGCAGAGGCTCTCCGG - Intronic
1147168207 17:38604496-38604518 GAGGCTGGACCGAGGGACCCTGG - Intronic
1147243055 17:39103245-39103267 TAAGCTGGGCTCAGTGACCCAGG + Intronic
1148133642 17:45277644-45277666 CAAACTGAGCTGAGGCACCCCGG + Intronic
1148437595 17:47695406-47695428 CAAACTGGGGAAGGGGACCCAGG - Exonic
1148774519 17:50088055-50088077 CAAGCTGGAAAGGGGGACCCAGG + Intronic
1148799169 17:50212302-50212324 CCAGCTGGTCCAAGGGACCCGGG + Intergenic
1149457285 17:56798184-56798206 TAAGCTGGGCAGAGGCAGTCGGG - Intronic
1149626670 17:58084472-58084494 GAAGATGGCCAGAGGGCCCCAGG - Intronic
1151208080 17:72523031-72523053 TAAGCTGGGCACAGTGACTCAGG + Intergenic
1151985794 17:77542669-77542691 GAAGCTTGGCAGAAGGAGCCAGG + Intergenic
1152730081 17:81965862-81965884 CAGGCTGGGCACAGGGCACCAGG + Intergenic
1152744441 17:82032327-82032349 CTTGCTGGGCAGAGGGTCCGAGG + Intronic
1154200120 18:12293884-12293906 CAGGATGGGCAGGGGGAGCCAGG - Intergenic
1155802887 18:30131282-30131304 CAAGCTGAGCACAGGGTGCCCGG + Intergenic
1156262980 18:35461761-35461783 AGAGCAGGGCAGAGCGACCCTGG + Intronic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1157325942 18:46668961-46668983 CAAGCTGGGGTCAGGGACCATGG - Intronic
1160156786 18:76441032-76441054 GACCCTGGGCACAGGGACCCTGG + Intronic
1160435117 18:78845670-78845692 CCAGGTGGGCAAAGGGACCCTGG - Intergenic
1160494190 18:79361097-79361119 CAAGCAGGGCAGAGGTCACCAGG + Intronic
1161455943 19:4369763-4369785 GGAGCTGAGCAGAGGGACCCGGG - Intronic
1162334225 19:10050262-10050284 CAGGCTGGGCAGGTGGGCCCAGG + Intergenic
1162376523 19:10308533-10308555 CATGCAGGCCAGAGGGACCTGGG + Exonic
1162722011 19:12668214-12668236 CCAGCTGGATAGAGGGAACCTGG - Exonic
1162762155 19:12895146-12895168 CAAGATGGGGAGGGGGACCCAGG - Intronic
1163153920 19:15429836-15429858 CAAGCCGGGCCGGGGGGCCCCGG + Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1163785920 19:19274863-19274885 TGAGCTGGGCACAGGCACCCTGG - Intergenic
1163958137 19:20662717-20662739 CAAGCTGGGCAAAGAGAACTGGG + Intronic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164698208 19:30262659-30262681 CCAGGTGGTCAGAGGGACCTGGG + Intronic
1165002849 19:32779216-32779238 CAATGTGGGCAGAGGGGCACAGG + Intronic
1165323587 19:35100889-35100911 CCAGCTGGGCAGAGCGGCCCAGG + Intergenic
1165391630 19:35542411-35542433 TAAGCTGGGGAGAGGTGCCCAGG + Intronic
1165455480 19:35908118-35908140 CAAGCTGAGCCCAGGGACCCGGG + Intronic
1166892537 19:46002288-46002310 CAAGCTGGAAAGAGGGACGGGGG - Intronic
1166930628 19:46299164-46299186 CAAGCTGGGCAGAGTGCCAGGGG + Intronic
1167153415 19:47723131-47723153 CAGGGTGGGCAGGGGGATCCAGG - Intronic
1167738850 19:51312085-51312107 CTGGCTGGGCAGGGGGACCTCGG + Intronic
1168058221 19:53875386-53875408 CAGGCGGGGCCTAGGGACCCAGG - Exonic
1168269202 19:55240443-55240465 CAAGCTGGGGCTTGGGACCCTGG + Intronic
1168351180 19:55676872-55676894 AAACCTGGGCAGAGGGAGCTAGG - Exonic
926311530 2:11679264-11679286 GAAGATGGGGAGAGGAACCCAGG + Intronic
926736628 2:16078428-16078450 CCAGGTGGGCACAGGGACCGAGG + Intergenic
926763145 2:16297286-16297308 CATGCTAGGCAGAGAAACCCAGG + Intergenic
926862242 2:17321528-17321550 CCAGGTGGACAGTGGGACCCTGG + Intergenic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
928223121 2:29421773-29421795 CGATCTGGGCAGAGGTACACAGG - Intronic
928249208 2:29660157-29660179 CATGCTGGACAGAGGGACTGTGG - Intronic
930479206 2:51926003-51926025 CCAACTGTGCAGAGGGAGCCTGG + Intergenic
931691490 2:64838078-64838100 CAAGCTGGGCAGAGTGCCCTGGG + Intergenic
932285031 2:70524802-70524824 CCAGCTGAGCAGAGGGCACCTGG + Intronic
932290251 2:70570999-70571021 CAAGCTGGGCATTGGAACCATGG + Intergenic
932331397 2:70900351-70900373 CAAGCCCGGCAGAGGGAGACTGG - Intergenic
932441404 2:71738267-71738289 GAAGCTGGGCAGAGTGGTCCTGG + Intergenic
932488809 2:72105290-72105312 GAAGCAGGGCCGAGGGACACTGG - Intergenic
932621066 2:73265248-73265270 AAGGCTGGGCAGGGGGACACAGG - Intronic
932791127 2:74654926-74654948 CAAGCTGGAATGATGGACCCAGG - Intronic
933969466 2:87458508-87458530 CCCACAGGGCAGAGGGACCCGGG - Intergenic
934753484 2:96809526-96809548 CAGGGTGGGCAGGGGGCCCCGGG - Exonic
935649980 2:105373833-105373855 GAAGTTGGGCCGAGGCACCCTGG + Intronic
936022050 2:109002305-109002327 CAAGCTGGGAAGTGGAATCCCGG - Intergenic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
936269728 2:111040623-111040645 CAAGCTGGGCAGGGGGTGCAGGG + Intronic
936283139 2:111160124-111160146 GAAGCTGGGCAGAGGCAGCAAGG - Intronic
936324320 2:111491986-111492008 CCCACAGGGCAGAGGGACCCGGG + Intergenic
937308321 2:120885667-120885689 GCAGGTGGGCAGAGGGACTCAGG + Intronic
938277095 2:130036930-130036952 GAAGCTGGGAAGACGGACACCGG - Intergenic
938438288 2:131300459-131300481 GAAGCTGGGAAGACGGACACCGG + Intronic
944051802 2:195478498-195478520 CAACCTGAGCAGAAGCACCCAGG + Intergenic
944674868 2:202027006-202027028 CAAGCTGGGCACAGTGTCTCAGG + Intergenic
946249823 2:218405331-218405353 CAAGCTGGGCCAAGGGGCCCAGG + Exonic
946298805 2:218809521-218809543 CAAGCTGGGCAGGTGCTCCCAGG - Intronic
947732111 2:232437009-232437031 CAAGCAGGCCAGAGGCAGCCAGG - Intergenic
947851928 2:233295181-233295203 CAGGCTTGGCAGAGGGGCCATGG - Exonic
948461482 2:238131986-238132008 CCGGCTGGGCAGAGGTGCCCTGG - Exonic
948646069 2:239405945-239405967 AAAGCTGGGCAAGGGGACCCAGG - Intergenic
948752322 2:240139807-240139829 CACACTGGGCAGGGGGAGCCAGG - Intronic
948756338 2:240161645-240161667 CAAGCCAAGGAGAGGGACCCGGG - Intergenic
949031538 2:241799544-241799566 CAGGCAGGGGAGAGGGTCCCAGG - Intronic
1168768428 20:397870-397892 AAAGCTGCGCACAGGGACCCCGG + Intergenic
1168850752 20:975261-975283 CAAGATGTGTAGAAGGACCCAGG - Intronic
1169214112 20:3783951-3783973 CATCCTGGGCAGAGGGGCCTGGG - Exonic
1169406574 20:5326339-5326361 CAAGCTGGGGAGAGGAATCTGGG + Intergenic
1169911558 20:10651505-10651527 CACGCTGGGGAGAGGTACCTAGG - Intronic
1171495717 20:25553816-25553838 CAAGTTGGGCAGAGTGAGCAGGG - Intronic
1172499924 20:35418459-35418481 AAAGATGGGCAGAGGGAGCTTGG - Intergenic
1172884567 20:38222536-38222558 GAGGCTGTGCTGAGGGACCCCGG - Exonic
1172922702 20:38499162-38499184 CAAGGGGGACAGAGGGACACAGG - Intronic
1173516415 20:43667865-43667887 CAAGCTGGGGCGCGGAACCCAGG - Intronic
1174130532 20:48340813-48340835 CAAGCTGGGCAGGGCATCCCAGG - Intergenic
1175206772 20:57317318-57317340 CAAGTGGGGCAGAGGGCTCCAGG - Intergenic
1175904363 20:62372282-62372304 CATGCTGGGCAGGGTGACTCGGG + Intergenic
1175933394 20:62503891-62503913 CAAGGTGGGCACAGGCACCAGGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1178252808 21:31020742-31020764 CAGGCTGGGTAGAGGGACAACGG + Intergenic
1178351537 21:31875175-31875197 CAGGCTGGGCAGAGGCCCCCAGG - Intronic
1178707296 21:34886704-34886726 CAAGCTAGGAAGACCGACCCGGG + Intronic
1179614440 21:42572805-42572827 CAAGCTGGCAGGAGGGAGCCTGG - Intronic
1180021804 21:45133323-45133345 CATGCTGGGAAGAGGGCCACAGG - Intronic
1180168118 21:46040516-46040538 CAGGCTGGGCGCAGGGACCAGGG + Intergenic
1180800775 22:18630925-18630947 CAAGCTAAGCAGAGGAGCCCTGG + Intergenic
1180852008 22:19026482-19026504 CAAGCTAAGCAGAGGAGCCCTGG + Intergenic
1181155472 22:20917489-20917511 CAAGCTGGGCAAAAGCACCCCGG + Exonic
1181220942 22:21364337-21364359 CAAGCTAAGCAGAGGAGCCCTGG - Intergenic
1181549335 22:23628011-23628033 CAGGGTGGGTAGAGGGGCCCTGG - Intronic
1181883864 22:26003355-26003377 CAAACTGGACAGAGAGAGCCAGG - Intronic
1182093820 22:27613280-27613302 CAAGCAGGGCAGATGAGCCCTGG + Intergenic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182445224 22:30386102-30386124 GAAGCAGGGCAGAGGCACCCAGG + Exonic
1183420961 22:37710932-37710954 AAAGCTGTGCAAAGGGAACCAGG - Intronic
1183548350 22:38467416-38467438 CAAGCTGGTCAGGGAGATCCAGG - Intergenic
1183619552 22:38964648-38964670 AGAGCAGGGCAGAGGGACCCTGG - Intronic
1183640352 22:39088939-39088961 AAGGCAGGGCAGAGGGACCCTGG - Intergenic
1183719485 22:39554232-39554254 CAAGCTGGGCTGAAGGAAACTGG - Intergenic
1183733709 22:39631996-39632018 CCAGCTGGGCAGAGTGAGGCGGG + Intronic
1184094532 22:42309423-42309445 CAAGCTGGGGAGGGAGGCCCAGG - Intronic
1184409061 22:44316189-44316211 CACCCTGGGGAGAGGGACCTGGG + Intergenic
1184495258 22:44837423-44837445 CATGCTGGGCAGGAGGACTCTGG - Intronic
1184594038 22:45503378-45503400 CTAGCTGGGCTGGGGGACGCTGG + Intronic
1185214049 22:49588291-49588313 CCATCTGGGCAGAGGGTCCAGGG - Intronic
1185278460 22:49960010-49960032 CCAGCAGGGCAGAGGTACCAGGG + Intergenic
950264310 3:11562969-11562991 CAGGCTGGGGAGAGGGAGACAGG + Intronic
950483091 3:13256803-13256825 CGAGAAGGGGAGAGGGACCCTGG + Intergenic
950667424 3:14505856-14505878 CCAGCTGTGCTGAGTGACCCTGG + Intronic
953039895 3:39246532-39246554 CAAGTTGGGGTGAGGGACTCAGG + Intergenic
954443421 3:50534096-50534118 CAGGCTGGGGAGAGAGACCGGGG - Intergenic
956170222 3:66427516-66427538 CAGGCTGGGCACAGTGACTCTGG + Intronic
958549640 3:95595676-95595698 CCAGCTGTGCTGGGGGACCCGGG + Intergenic
959991431 3:112636619-112636641 TAATCTGGGCAGAGGAACTCTGG - Intronic
960941358 3:122937138-122937160 GAAGCTGGGCGGGGGCACCCTGG + Intronic
961137961 3:124529591-124529613 CAAGGTGGACAGTGGAACCCAGG + Intronic
962471273 3:135711382-135711404 CTATCTGGGCAGCTGGACCCTGG - Intergenic
962866033 3:139448612-139448634 GAAGGTGGGGAGAGGAACCCAGG - Intergenic
968443392 4:636006-636028 CGAGATGGGCGGAGGGACCCTGG - Intronic
968447918 4:661824-661846 CAAGCTGGGAGGAGGACCCCTGG - Intronic
968517762 4:1022055-1022077 CAAGATGAGCAGAGGGGCCGAGG - Intronic
968729909 4:2264767-2264789 CAAGATGGGCAGAGGCATCTTGG + Intergenic
968813286 4:2809508-2809530 CAGGCTGGGTACAGGGTCCCTGG + Intronic
969497068 4:7532223-7532245 CAAGGTCGGCAGAGGCACCAGGG + Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
977682395 4:99810874-99810896 GAAGGTGGGGAGAGTGACCCAGG + Intergenic
977864576 4:102009199-102009221 CAAGTTGGGCAGCAGGAGCCAGG - Intronic
979041849 4:115808406-115808428 CAAGCTGGGGAGAGTGTCTCTGG + Intergenic
980988632 4:139719024-139719046 CATGCTGGGCAGAGGGGCTCTGG + Exonic
982289364 4:153764343-153764365 CCAGTTAGGCAGAGGGACCAAGG - Intergenic
985082254 4:186278078-186278100 CAAGCTGGGCATAGTGGCTCAGG - Intronic
985967848 5:3351285-3351307 CTTGCTGGACAGGGGGACCCAGG - Intergenic
986717613 5:10535301-10535323 GAACCCGGGCAGGGGGACCCTGG + Intergenic
986750919 5:10787185-10787207 GAAGATGGGCAGAGGTACTCAGG + Intergenic
988285104 5:29204718-29204740 GAACCTGGGAAGGGGGACCCTGG + Intergenic
991673937 5:69074510-69074532 CTGGCTGGGCAGAAGGATCCCGG - Intergenic
991700968 5:69316138-69316160 CAAGGAGGGCAGAGTGACTCTGG + Intronic
994671587 5:102767971-102767993 CAAGCTTGCCAGAGTGACACAGG - Intronic
995458492 5:112377345-112377367 GAAACTGGGCAAAGGGACACAGG + Intronic
995683382 5:114745098-114745120 TGTGCAGGGCAGAGGGACCCTGG - Intergenic
997237059 5:132278779-132278801 CAGGTGGGGCAGAGGGACTCAGG - Intronic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
998249317 5:140540440-140540462 CAAGCTAAACAGAGGAACCCTGG + Intronic
998471869 5:142389889-142389911 GAAGCAGGGCAGAGGGACGTAGG + Intergenic
998813683 5:145991473-145991495 AAAGCAGGGCAGAGGGAAGCAGG - Intronic
999313742 5:150570477-150570499 CCAGCTGTGCAGATGGGCCCTGG - Intergenic
999410264 5:151344212-151344234 CAACATGGGCACAGGGATCCTGG - Exonic
1000242648 5:159422923-159422945 GTAGGTGGGCAGAGGGAGCCAGG - Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG + Intronic
1002363402 5:178691854-178691876 CATGCTGTGCAGAGGGGCCCTGG + Intergenic
1002425405 5:179171879-179171901 CAAGCTAGGCTGAGGGGCCTGGG + Intronic
1002458140 5:179357685-179357707 CCAGCAGGGCAGTGGGACCAGGG + Intergenic
1002518002 5:179773778-179773800 CACACTGGGAAGAGGGCCCCGGG - Intronic
1002565984 5:180113192-180113214 CAGGATGGACAGAGGGACCGGGG + Intronic
1003333994 6:5153455-5153477 CCAGCTGGGCAGAGAGAAGCTGG + Intronic
1003494614 6:6653387-6653409 CAAGCGGAGCAGAGGGACTGTGG - Intronic
1004899780 6:20183383-20183405 CAAGCTGGTCAGCTGGACCCAGG - Intronic
1006030013 6:31171513-31171535 CAGGCTGGGCAGATGGTGCCAGG - Intronic
1006294205 6:33162735-33162757 GAAGCTGGGCACAGGGTCCTGGG + Exonic
1007615832 6:43179442-43179464 CAAGCTGGCGAGGGGGTCCCAGG - Exonic
1013038631 6:106411685-106411707 CAAGCTGGGGAGAGAGAAGCTGG + Intergenic
1015288305 6:131509474-131509496 CAAGATGGCGAGAGTGACCCCGG + Intergenic
1015414373 6:132932050-132932072 CAAGCTGGGCTGAGCCACCCGGG - Intergenic
1016396715 6:143631518-143631540 CAAGCTCTGCAGATGGAGCCAGG - Intronic
1016404197 6:143713379-143713401 CAAGCTGGGCAATGGGTCCATGG + Intronic
1017665694 6:156718788-156718810 GAAGCTGGGCTGAGTCACCCAGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018397853 6:163393971-163393993 CCAGCAGGGCAGAGGGAGCTGGG - Intergenic
1018672636 6:166192508-166192530 CGAGCTGGGCTGAGGCACGCAGG + Intergenic
1018951907 6:168384704-168384726 CAAGCCTGGCGGAGGCACCCCGG - Intergenic
1019640034 7:2098458-2098480 GCAGCAGGGGAGAGGGACCCTGG - Intronic
1019662461 7:2232526-2232548 CACGGTAGGCAGCGGGACCCCGG + Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1020257327 7:6509371-6509393 CAAGCTGGAGAGAGGGTCCTAGG + Intronic
1022675596 7:32495853-32495875 GAAGCAGGGCAGGGGGGCCCCGG - Intronic
1024075775 7:45817196-45817218 GAAGCTGGGCTGAGCCACCCGGG - Intergenic
1025021911 7:55486904-55486926 ACAGCAGGGCAGATGGACCCAGG - Intronic
1026759759 7:73117681-73117703 TAAGCTGGGCAGTGGGTCCATGG + Intergenic
1026791499 7:73335429-73335451 CAAGCTGGGCAGCAGGACAGAGG + Intronic
1027036097 7:74926494-74926516 TAAGCTGGGCAGTGGGTCCATGG + Intergenic
1027087651 7:75275789-75275811 TAAGCTGGGCAGTGGGTCCATGG - Intergenic
1029155220 7:98512611-98512633 AAAGGTGGGCAGAGTGGCCCTGG + Intergenic
1029371890 7:100155557-100155579 AAAGCTGGGCAGAGGGAAGGTGG - Intronic
1029527431 7:101103609-101103631 CAAGCTGGCCCGAGGCTCCCAGG + Intergenic
1032792859 7:135255244-135255266 CAAGGTGGGCAGAGGTACCACGG - Intronic
1034496936 7:151428652-151428674 CCAGCAGGGCAGGGGGACCTAGG + Intergenic
1035281229 7:157779669-157779691 CGAGCTGGGGTGAGGGGCCCCGG + Intronic
1035355637 7:158274585-158274607 CAAGCTGGGCCGAGCGCCTCGGG - Intronic
1036587300 8:10136169-10136191 CACGCTGGGCACAGGGACCCCGG + Intronic
1037601141 8:20395218-20395240 AAAGCTTGCCAGAGAGACCCAGG - Intergenic
1038987990 8:32834226-32834248 CAAAGTGGGCAGGGGGACACAGG + Intergenic
1039484628 8:37900819-37900841 CCAGCTCTGCAGAGGGACCTTGG - Intergenic
1042390788 8:68231121-68231143 CAAGCTATGCAGAGGGGCACTGG + Intronic
1042400600 8:68341677-68341699 CAGGATGGGCAGAGGGGCACAGG - Intronic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1043354143 8:79392731-79392753 CAAGATGGGAAGAGGAACCAAGG - Intergenic
1044373300 8:91440213-91440235 GAATCTTGGAAGAGGGACCCTGG + Intergenic
1046984198 8:120369421-120369443 CAGGCTGGCCAGAAGGACCTTGG - Exonic
1048025066 8:130578503-130578525 CTGGCTTGGCAGAGGGACCAGGG + Intergenic
1048274561 8:133056522-133056544 TGAGGTGGGGAGAGGGACCCTGG + Intronic
1048522591 8:135170756-135170778 CAAGCTTGGCAGTGGGAACCAGG + Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049206757 8:141367155-141367177 GAAGCTGGGGAGAGGGAGGCTGG + Intronic
1049217592 8:141415239-141415261 CAGGCTGGGAAGAGGGTCCCAGG - Intronic
1049251857 8:141593454-141593476 CAGGCTGGGAAGGGGCACCCAGG + Intergenic
1049255425 8:141611219-141611241 CGAGCTCTGCAGAGGGTCCCGGG + Intergenic
1049463845 8:142742161-142742183 GAAGCTGGGCTCTGGGACCCAGG + Intronic
1049629383 8:143644472-143644494 CTTGCTGGGCAGTGGGAGCCGGG - Intronic
1051367521 9:16331746-16331768 AAAGCAGAGCAGAGGGCCCCAGG + Intergenic
1053165561 9:35841522-35841544 GAAGCTGGGCACAAAGACCCTGG - Exonic
1056464613 9:86841567-86841589 CAAGCTCAGAAGAGGGACTCAGG + Intergenic
1056666614 9:88586150-88586172 GAAGCTGGGCTGGGGGACCTTGG - Intergenic
1056991815 9:91420520-91420542 CAAGCTGGGGCCTGGGACCCAGG + Intronic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1059501464 9:114757354-114757376 CAACCTGGGCAGAGGGGTCAGGG + Intergenic
1061042928 9:128150106-128150128 CTAGCTGGGCAGCAGGGCCCAGG - Intronic
1061060230 9:128246561-128246583 GAAGCTGGGTACAGGGATCCAGG + Intronic
1061249837 9:129420286-129420308 CTAGGTGGGCAGAGGGAGCCGGG + Intergenic
1061604374 9:131697852-131697874 GGACCTGGGCAGAGGGAACCTGG + Intronic
1062454539 9:136629397-136629419 CCAGCTGGGGAGTGGGGCCCCGG + Intergenic
1062505229 9:136870674-136870696 CATGGTGGGCAGAGGGACAGGGG - Intronic
1062610531 9:137371482-137371504 CTTGCTGGGAAGAGGAACCCAGG + Intronic
1203761158 EBV:13420-13442 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203762087 EBV:16492-16514 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763016 EBV:19564-19586 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763945 EBV:22636-22658 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203764874 EBV:25708-25730 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203765803 EBV:28780-28802 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203766732 EBV:31852-31874 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203767661 EBV:34924-34946 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1185627724 X:1494162-1494184 CAAGCTAGGCAGGGGGTCCTGGG + Intronic
1191800695 X:65075887-65075909 TAAGCTGGGCAGAGAGACCATGG + Intergenic
1194828987 X:98597193-98597215 AAAAAAGGGCAGAGGGACCCTGG + Intergenic
1200062803 X:153491123-153491145 GGAGCAGGGCAGAGGGAGCCCGG + Intronic
1200134650 X:153869013-153869035 GAAGCCGTGCAGAGGGTCCCTGG - Intronic