ID: 998134668

View in Genome Browser
Species Human (GRCh38)
Location 5:139668409-139668431
Sequence TGCCGCCCCGGCGCCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 440}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998134659_998134668 21 Left 998134659 5:139668365-139668387 CCAGCCGGACGCGGACGTGCCTG 0: 1
1: 0
2: 0
3: 4
4: 38
Right 998134668 5:139668409-139668431 TGCCGCCCCGGCGCCCGCCCGGG 0: 1
1: 0
2: 4
3: 55
4: 440
998134657_998134668 25 Left 998134657 5:139668361-139668383 CCTCCCAGCCGGACGCGGACGTG No data
Right 998134668 5:139668409-139668431 TGCCGCCCCGGCGCCCGCCCGGG 0: 1
1: 0
2: 4
3: 55
4: 440
998134658_998134668 22 Left 998134658 5:139668364-139668386 CCCAGCCGGACGCGGACGTGCCT 0: 1
1: 0
2: 0
3: 2
4: 27
Right 998134668 5:139668409-139668431 TGCCGCCCCGGCGCCCGCCCGGG 0: 1
1: 0
2: 4
3: 55
4: 440
998134664_998134668 2 Left 998134664 5:139668384-139668406 CCTGCGCGGCTCTGGCGGCCGCG No data
Right 998134668 5:139668409-139668431 TGCCGCCCCGGCGCCCGCCCGGG 0: 1
1: 0
2: 4
3: 55
4: 440
998134660_998134668 17 Left 998134660 5:139668369-139668391 CCGGACGCGGACGTGCCTGCGCG 0: 1
1: 0
2: 0
3: 3
4: 21
Right 998134668 5:139668409-139668431 TGCCGCCCCGGCGCCCGCCCGGG 0: 1
1: 0
2: 4
3: 55
4: 440
998134656_998134668 28 Left 998134656 5:139668358-139668380 CCGCCTCCCAGCCGGACGCGGAC 0: 1
1: 0
2: 0
3: 10
4: 216
Right 998134668 5:139668409-139668431 TGCCGCCCCGGCGCCCGCCCGGG 0: 1
1: 0
2: 4
3: 55
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998134668 Original CRISPR TGCCGCCCCGGCGCCCGCCC GGG Intronic