ID: 998135121

View in Genome Browser
Species Human (GRCh38)
Location 5:139670375-139670397
Sequence GCCTCTGAGAAACCAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998135121_998135126 20 Left 998135121 5:139670375-139670397 CCCTGGGTTGGTTTCTCAGAGGC 0: 1
1: 0
2: 1
3: 13
4: 182
Right 998135126 5:139670418-139670440 ACCAGCCCCCACCACAGCCCAGG 0: 1
1: 0
2: 12
3: 71
4: 724
998135121_998135123 -8 Left 998135121 5:139670375-139670397 CCCTGGGTTGGTTTCTCAGAGGC 0: 1
1: 0
2: 1
3: 13
4: 182
Right 998135123 5:139670390-139670412 TCAGAGGCACAAACTGAACCTGG 0: 1
1: 0
2: 0
3: 19
4: 191
998135121_998135124 -4 Left 998135121 5:139670375-139670397 CCCTGGGTTGGTTTCTCAGAGGC 0: 1
1: 0
2: 1
3: 13
4: 182
Right 998135124 5:139670394-139670416 AGGCACAAACTGAACCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998135121 Original CRISPR GCCTCTGAGAAACCAACCCA GGG (reversed) Intronic
900357123 1:2270399-2270421 GCCTGTGAGGGACCAACGCAGGG - Intronic
901455292 1:9359769-9359791 GCCTCTGAGAGGCCAGGCCAGGG + Intronic
903179287 1:21597351-21597373 GCCTCAGAGAACCCCACCCTGGG + Intronic
903396255 1:23003874-23003896 TCCTCAGACCAACCAACCCAAGG - Intergenic
905957099 1:42006807-42006829 GTCTCTGAGAAACCCATTCAGGG - Intronic
910248080 1:85164233-85164255 GACGTTAAGAAACCAACCCAAGG + Intronic
910486263 1:87717816-87717838 TCCTCCAAGAAACCAAACCAAGG + Intergenic
911082414 1:93946443-93946465 GCCTCTGAGTAACCTCCCCCAGG - Intergenic
913521242 1:119647716-119647738 CCCTCGGAGAAACCAAGCCCAGG - Exonic
914409712 1:147414540-147414562 TCTTTTGAGAAACCAAGCCAAGG - Intergenic
915550762 1:156632414-156632436 GCCTCAGAGAATCCTCCCCAAGG + Intergenic
917725647 1:177824927-177824949 GCCTATGAGCAACCATCCCCTGG - Intergenic
917980857 1:180268042-180268064 GCCTCTGCAAACCCATCCCAAGG + Intronic
919576979 1:199322493-199322515 GCATCTGAGAATCCACCCCTGGG - Intergenic
919865606 1:201780655-201780677 GCCTATGAGAACCAATCCCATGG - Intronic
920862471 1:209721771-209721793 GCCTCTGGGAAGCCAATCCTTGG + Intronic
922036845 1:221857057-221857079 GCTACTGAGAAACCAGCCTATGG - Intergenic
923330943 1:232924145-232924167 GCTTGCCAGAAACCAACCCAAGG + Intergenic
923962473 1:239101721-239101743 TCCTCTGACCAACCAGCCCAAGG + Intergenic
924453756 1:244201540-244201562 TTCTCTGAGTAACCAACCCTGGG - Intergenic
1069753653 10:70760680-70760702 GCCCCTGAGACACCAATCCCTGG + Exonic
1069868723 10:71520357-71520379 GACTCTGTGAAACCAGCACAGGG + Intronic
1070177412 10:73983727-73983749 GCATGTGAGAAAACTACCCAAGG - Intergenic
1070639607 10:78158257-78158279 AGCTCAGAGAACCCAACCCAAGG - Intergenic
1072533464 10:96341383-96341405 GCATGTGAGAAAACTACCCAAGG - Intergenic
1073454836 10:103630151-103630173 GCTTCTGAGCAACCAAACCATGG - Intronic
1074354479 10:112769927-112769949 GCTTCTCAGAATCCACCCCATGG + Intronic
1076946865 10:133657459-133657481 GTCCCTGAGTAACCAACACAAGG - Intergenic
1078061213 11:8045982-8046004 GCTTGTGAGAAAACGACCCAAGG - Intronic
1078087336 11:8242166-8242188 GCTTTTGAGAAGCCATCCCAGGG + Intronic
1079475724 11:20827088-20827110 GACTCAGATAAACCAAGCCATGG - Intronic
1080450837 11:32377602-32377624 GCCTCTGAGAGAAGAAACCAAGG + Intergenic
1083278111 11:61608916-61608938 GCTGCTGAGAAACGAACCCTTGG - Intergenic
1085273881 11:75285936-75285958 GCCTCTGAGAGGCCACCTCAGGG + Intronic
1085646563 11:78227450-78227472 GCCACTGTGAAACTAGCCCATGG + Intronic
1086132864 11:83419647-83419669 TCCTCAGACCAACCAACCCAAGG + Intergenic
1086984967 11:93237799-93237821 GGATTTGAGAAATCAACCCAGGG + Intergenic
1088796291 11:113269189-113269211 GCCCCTGGGAGATCAACCCATGG - Intronic
1089048865 11:115528460-115528482 GCCTCTGGGAATAAAACCCAGGG + Intergenic
1089060498 11:115622449-115622471 GCCCCTAAGGAACCATCCCAAGG + Intergenic
1091335275 11:134761939-134761961 GTCTCTGAGAAACTGAGCCAGGG + Intergenic
1091646260 12:2274542-2274564 GCCCCTCAGAAAGCAAACCAGGG + Intronic
1091693587 12:2612987-2613009 GCCTCTGGGAAAACTACCAAAGG - Intronic
1093208709 12:16282032-16282054 GCTTCTGAAAAACCATCCTAAGG - Intergenic
1093423072 12:18997522-18997544 GCCTCTAAGAACCCAGCCTAGGG - Intergenic
1093891545 12:24527187-24527209 GCCTATGAGTACCTAACCCATGG + Intergenic
1096139248 12:49228906-49228928 GGCTTTGAGAAACCAGCCCAAGG + Intronic
1096256350 12:50064333-50064355 ACATCTGAGACCCCAACCCAGGG - Intronic
1103321795 12:120096524-120096546 GCCTCTGAGCTCCAAACCCAGGG - Exonic
1104427955 12:128693547-128693569 GCCTCTGAAAACCGAGCCCATGG + Intronic
1111980105 13:95006256-95006278 GCCTCCGAGCTACCAGCCCATGG - Intergenic
1112237425 13:97648995-97649017 GCCTCTCAAACACCAGCCCATGG + Intergenic
1113322324 13:109246212-109246234 GCATGTGAGAAAGCCACCCAAGG + Intergenic
1116613038 14:47102648-47102670 CCCTCTGAGAGACCAAGTCAAGG + Intronic
1117307329 14:54489191-54489213 GCAAGTGAGAAACAAACCCAAGG + Exonic
1118084535 14:62399433-62399455 TCCACTGAGAAAGCAACACAGGG - Intergenic
1119472287 14:74907551-74907573 GCCTCTGAGGAGGCAACCCCAGG + Intronic
1121441038 14:93949593-93949615 GCCTCTGAGAGCCCAACAGAGGG - Intronic
1122786261 14:104164540-104164562 GCCACAGAGAAGCCACCCCAGGG + Intronic
1123130203 14:105979353-105979375 GCCACTGAGAAACCATCTGAAGG + Intergenic
1202920940 14_KI270723v1_random:30014-30036 GTCCCTGAGTAACCAACACAAGG - Intergenic
1202923975 14_KI270724v1_random:7567-7589 GTCCCTGAGTAACCAACACAAGG + Intergenic
1127770851 15:62229519-62229541 TCCTCTCAGAACCCAGCCCATGG + Intergenic
1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG + Intergenic
1129235624 15:74222142-74222164 GCCTCTGAGAGCCCAGCCCCAGG - Intergenic
1130060661 15:80567527-80567549 GCCTCGGAGAAAGCATCCCCAGG + Intronic
1130403928 15:83581317-83581339 CCAACTGAGAAACAAACCCAGGG + Intronic
1132844632 16:1994319-1994341 GCCTCTCAGATACCAATCCCTGG - Intergenic
1132846501 16:2003292-2003314 TCCTCTGAGAGACCAGCCCTGGG + Intronic
1132982353 16:2744995-2745017 GCATGGGAGAAACCAACCCCAGG + Intergenic
1133932169 16:10241539-10241561 GCCACTGAGAAACCAAGCGAGGG - Intergenic
1140208678 16:72953967-72953989 GCCTCAGAGAAACAAGCCCAGGG + Intronic
1141646406 16:85370266-85370288 GCCTCTGAGCAACGCACCCCAGG + Intergenic
1142237510 16:88929228-88929250 GCCGCTGTGCAAACAACCCAGGG + Intronic
1143135452 17:4710258-4710280 GCCACTGAGAAAGCAAACAAAGG + Intergenic
1143615788 17:8048367-8048389 GCCTCTGAGGATCCACCACAAGG - Exonic
1145080882 17:19893373-19893395 TCCTCAGACCAACCAACCCAAGG - Intergenic
1146542169 17:33705899-33705921 GCCTCTGGGAAACAAAACTAGGG - Intronic
1146977783 17:37130333-37130355 CCCTCAGAACAACCAACCCATGG - Intronic
1147918137 17:43900658-43900680 CCCTCTGAGGAACCAGCCAATGG + Intronic
1148234055 17:45955667-45955689 ACCTCTGAGAATCCAACAGAAGG + Intronic
1148477132 17:47936175-47936197 GCCTCTGATAAACCCACTCAGGG + Intergenic
1152291136 17:79440844-79440866 GCCTCTGAGGGACAAACCCTGGG - Intronic
1155961731 18:32001042-32001064 TCCTCAGACCAACCAACCCAAGG + Intergenic
1157086516 18:44585934-44585956 GCCCCTGAGTATCCAGCCCAAGG + Intergenic
1158861237 18:61594231-61594253 GTTCCTGGGAAACCAACCCAGGG - Intergenic
1159828897 18:73249368-73249390 CCCTCTCTGACACCAACCCATGG - Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160347279 18:78144043-78144065 GCCTCTTACAAACCACCACAGGG - Intergenic
1164244992 19:23420982-23421004 GGCCCTGAGTAACCAACACAAGG + Intergenic
1164309047 19:24030427-24030449 GGCCCTGAGTAACCAACACAAGG - Intergenic
1164731532 19:30508606-30508628 GCCTCTTAGAAATTAAACCAGGG - Intronic
1166271877 19:41719530-41719552 GGCTCAGAGAAAACACCCCACGG + Intronic
1166561417 19:43734659-43734681 TCCTCTCAGATACCAACCCATGG + Intronic
1166856472 19:45784844-45784866 GGATCTGAGGAACCAAGCCACGG + Intronic
1168666956 19:58211409-58211431 TGCTCAGAGACACCAACCCAGGG - Intronic
925041275 2:733245-733267 GCCTCTGAGGAACCCACCACTGG - Intergenic
926703459 2:15819597-15819619 GACTCTGAGAAAGCAGCCAAGGG - Intergenic
927921242 2:26973411-26973433 CCATATGAGAATCCAACCCAGGG + Intronic
929258534 2:39839480-39839502 TCCTCTGAGAACCCAACTCCCGG - Intergenic
929292890 2:40213631-40213653 GCATCTGACAAACAATCCCAAGG + Intronic
929794717 2:45050122-45050144 ACCTCTTGGAAACCAACCCCCGG + Intergenic
931040316 2:58290252-58290274 GACTGTGAGAAACCAAACAATGG + Intergenic
931613782 2:64133546-64133568 CCCTCTTTGGAACCAACCCATGG - Intronic
931784834 2:65609268-65609290 GCCTCTCTGAAAGCAGCCCACGG + Intergenic
932171283 2:69558801-69558823 GCCTCTGAGAAATAAAGCCTCGG + Intronic
932764018 2:74458853-74458875 GCCTCATAGAACCCATCCCATGG + Intronic
940654353 2:156470121-156470143 GCCTCTGACAAAGGGACCCAGGG + Intronic
941684894 2:168438196-168438218 GCCACTAAAAATCCAACCCAAGG - Intergenic
946156485 2:217809990-217810012 GGCTGGAAGAAACCAACCCAAGG + Exonic
946650316 2:221886075-221886097 CCCTCTTATAAACCATCCCATGG - Intergenic
946723529 2:222637467-222637489 GCAGCTGAGAAAACTACCCAAGG + Intronic
948062143 2:235049940-235049962 GCCTCTGGGCACCCAACCCCAGG - Intronic
1169289036 20:4332920-4332942 GTTTCTGGGAACCCAACCCAAGG - Intergenic
1169392666 20:5203078-5203100 GCCTGTGAGATACCCACACAGGG + Intergenic
1170962044 20:21034122-21034144 GCCTCTGAGGAACCTAGCAAGGG - Intergenic
1172106512 20:32520317-32520339 GCCTCTGATAAGTAAACCCACGG - Intronic
1174193687 20:48758010-48758032 GCATCTGGGGAACCACCCCAAGG - Intronic
1181377748 22:22473842-22473864 GGCTCTGAGAGACCAAGACAGGG - Intergenic
1182645962 22:31809614-31809636 GCCTCTGAGAAAGCAAAAAATGG + Exonic
1182718386 22:32377961-32377983 GTCTCTGAGAAAATCACCCATGG - Intronic
1184956037 22:47886440-47886462 GCCTCTGTTAGAGCAACCCATGG - Intergenic
949389087 3:3538680-3538702 GTCTATGAGTTACCAACCCAGGG - Intergenic
951632193 3:24734488-24734510 CCCACTGAGAAAGCAATCCAAGG + Intergenic
951763040 3:26165350-26165372 TCCTCAGACCAACCAACCCAAGG - Intergenic
953032808 3:39189180-39189202 GGCTCTGAGGAACCCACCGAGGG - Exonic
953662838 3:44903686-44903708 GCCTCTCAGAAAGCCTCCCAGGG - Intronic
953678101 3:45018976-45018998 GCCTCCGGGAAACCACCCCATGG - Intronic
953927726 3:46990865-46990887 GCATCTGAGAAACTAAGCCCTGG + Intronic
954707126 3:52487084-52487106 GACCCTGAGAAACCAACCCATGG - Intronic
954804024 3:53204931-53204953 GCATCTGAGGAAACCACCCAAGG + Intergenic
956019329 3:64916707-64916729 GCAGCTGAGAAACTAGCCCATGG + Intergenic
956790117 3:72673684-72673706 GCCGCTGAGAACCCACCCTAGGG + Intergenic
956924666 3:73970881-73970903 GCCACTTAGAAAACAAACCAGGG - Intergenic
957080591 3:75632957-75632979 GTCCCTGAGTAACCAACACAAGG + Intergenic
960386936 3:117032118-117032140 GCCTCTGAAAAACAAAACAAAGG - Intronic
960814564 3:121659554-121659576 ACCTCTTAAAAACCAGCCCAGGG + Intronic
960814641 3:121660118-121660140 GCCTCTGAGGGACCATCACAAGG + Intronic
961151216 3:124639878-124639900 GATTCTAAGAAACCAAACCACGG - Intronic
961604937 3:128086581-128086603 GCCTCGGAGACACCAATTCAGGG + Intronic
964285607 3:155114555-155114577 GTCTCTGAGACTCCAAGCCATGG - Intronic
965049056 3:163620609-163620631 TCTTTTGAGAAACCAAACCATGG - Intergenic
967344024 3:188433457-188433479 GTCTCTTAGCAACCAACCCCAGG + Intronic
969634869 4:8362318-8362340 GACTCTGAGAAACGAAACAAAGG - Intergenic
980086012 4:128390749-128390771 GGCTTTAAGAAACCTACCCAAGG + Intergenic
980101578 4:128546713-128546735 GCCTCTGAAAAAGAAATCCAAGG - Intergenic
981268670 4:142818373-142818395 GCCTCTGAGAGAAAAACCCATGG - Intronic
982899744 4:160983185-160983207 GCCTGTTAGGAGCCAACCCACGG + Intergenic
984411494 4:179403980-179404002 TCCTCAGAGCAACCATCCCAAGG + Intergenic
985034515 4:185824576-185824598 GTCTGTGAAAAACCAACTCAGGG + Intronic
985450321 4:190058258-190058280 GTCCCTGAGTAACCAACACAAGG - Intergenic
986541433 5:8848556-8848578 GCTTCTTACAAATCAACCCATGG - Intergenic
988098838 5:26653103-26653125 GCCCATTAGAAACCAACCAAAGG - Intergenic
988997052 5:36724809-36724831 CCCTCTAAGGAACCGACCCATGG - Intergenic
989316413 5:40084733-40084755 GCCTCTGAGAAACAAAAGCTAGG + Intergenic
989458421 5:41668563-41668585 GTCTCTGAGAACCCAAGTCAGGG + Intergenic
992377619 5:76204069-76204091 GCCTCTGAGCAATCTCCCCAAGG + Intronic
992955904 5:81907771-81907793 GCCTCAGAGAAGCCAAGACAGGG - Intergenic
998069881 5:139189193-139189215 GCCTATCAGAAACCCATCCAAGG + Intronic
998135121 5:139670375-139670397 GCCTCTGAGAAACCAACCCAGGG - Intronic
999343124 5:150790559-150790581 GCCTCTGACAAAGCTCCCCAGGG - Intronic
999458390 5:151736992-151737014 GCCTCTGAGGAACCACCATAGGG + Intergenic
1005885111 6:30091735-30091757 GAGTCAGAGAAACCAAGCCAGGG + Intergenic
1006287929 6:33112363-33112385 GACTCTGAGAAAAGAACCAATGG - Intergenic
1008771341 6:54982312-54982334 GCCCCTGAGAATCCAACTCTTGG - Intergenic
1010328585 6:74594373-74594395 GCTACTGAGAAACCAGCCTATGG - Intergenic
1014097398 6:117475339-117475361 GACTCTGAAAAACAAAACCAAGG + Intronic
1016371422 6:143378149-143378171 GCATGGGAGAAACCACCCCATGG - Intergenic
1017249096 6:152260687-152260709 ACCCCCGAGAAACCAACCCCTGG - Intronic
1019604329 7:1901010-1901032 CCCTCTGACAGACAAACCCAGGG + Intronic
1022289866 7:28990509-28990531 GCCTCTAAGACACCGACCCTAGG - Intergenic
1023298285 7:38739731-38739753 CCCTCTGAGAAGCCACCCCTTGG + Intronic
1024210822 7:47201992-47202014 GCTTCTAACAAACCAACCAAAGG - Intergenic
1028157114 7:87443147-87443169 GCATTTGTGAAACCAGCCCAAGG + Intronic
1030470267 7:109954384-109954406 GCCTCTGAGAAACATAACAAAGG + Intergenic
1031750361 7:125563890-125563912 GCCACTGAGCAGCCAACCCCAGG + Intergenic
1033266869 7:139894446-139894468 ACCACTTAGAAACCAACCCAGGG + Intronic
1037877492 8:22555091-22555113 GCCTCTGAGGAACCTCCTCATGG - Intronic
1040689793 8:49922524-49922546 GCCTTTGTGAAGCTAACCCATGG + Intronic
1044987665 8:97769441-97769463 GCCTCTGTGTAACCACCCAAGGG + Intergenic
1045174751 8:99710531-99710553 CACTCTGAGAAGCCAGCCCATGG - Intronic
1046392205 8:113589561-113589583 GACTCTAAGGAACTAACCCAAGG - Intergenic
1051356018 9:16240255-16240277 GGCCCTGAGAAACTCACCCAGGG + Intronic
1056455049 9:86751866-86751888 ACCTCTGAGATACCTAACCAGGG - Intergenic
1056936503 9:90919118-90919140 GCCTCTGAGTGCCCAGCCCATGG + Intergenic
1057890381 9:98865363-98865385 GCCTTTTAGAAACCAACTCAAGG + Intergenic
1058215667 9:102230549-102230571 GCTTCTGAGGAACCATCCCATGG + Intergenic
1058355533 9:104079478-104079500 GGCTCTGAGAAACAAAACAAAGG + Intergenic
1059589882 9:115647317-115647339 GCCTCTGAGTAAGCAAAACAAGG - Intergenic
1060968050 9:127722510-127722532 GCCTCTGTGAAGCCCACTCAAGG - Intronic
1061452998 9:130678659-130678681 GCCGCTGAGACACAGACCCATGG + Intronic
1061554196 9:131356641-131356663 GCCTCTGCAGAAACAACCCAAGG - Intergenic
1061744906 9:132732554-132732576 GTCTATGAGAAGCCACCCCAGGG + Intronic
1061826297 9:133260377-133260399 TCATCTGAGACACCTACCCAGGG - Intronic
1188608825 X:32070338-32070360 GCCTCTGTGGAAACCACCCATGG + Intronic
1190039614 X:47059277-47059299 GCCTCTGACAAACCAACCTCTGG - Exonic
1195570288 X:106392736-106392758 GCTTCAGGGAAACCAAGCCAAGG - Intergenic