ID: 998136539

View in Genome Browser
Species Human (GRCh38)
Location 5:139677077-139677099
Sequence GACCGCGGCTGGCGGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 933
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 884}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998136520_998136539 30 Left 998136520 5:139677024-139677046 CCCAGCTCCCGGCTGGCCGGCTC 0: 1
1: 0
2: 1
3: 21
4: 186
Right 998136539 5:139677077-139677099 GACCGCGGCTGGCGGGGCGGCGG 0: 1
1: 0
2: 1
3: 47
4: 884
998136529_998136539 8 Left 998136529 5:139677046-139677068 CCTGCATGGACAAAGGGGTCCTT 0: 1
1: 0
2: 0
3: 9
4: 119
Right 998136539 5:139677077-139677099 GACCGCGGCTGGCGGGGCGGCGG 0: 1
1: 0
2: 1
3: 47
4: 884
998136521_998136539 29 Left 998136521 5:139677025-139677047 CCAGCTCCCGGCTGGCCGGCTCC 0: 1
1: 0
2: 0
3: 41
4: 331
Right 998136539 5:139677077-139677099 GACCGCGGCTGGCGGGGCGGCGG 0: 1
1: 0
2: 1
3: 47
4: 884
998136526_998136539 14 Left 998136526 5:139677040-139677062 CCGGCTCCTGCATGGACAAAGGG No data
Right 998136539 5:139677077-139677099 GACCGCGGCTGGCGGGGCGGCGG 0: 1
1: 0
2: 1
3: 47
4: 884
998136522_998136539 23 Left 998136522 5:139677031-139677053 CCCGGCTGGCCGGCTCCTGCATG 0: 1
1: 0
2: 1
3: 25
4: 302
Right 998136539 5:139677077-139677099 GACCGCGGCTGGCGGGGCGGCGG 0: 1
1: 0
2: 1
3: 47
4: 884
998136523_998136539 22 Left 998136523 5:139677032-139677054 CCGGCTGGCCGGCTCCTGCATGG No data
Right 998136539 5:139677077-139677099 GACCGCGGCTGGCGGGGCGGCGG 0: 1
1: 0
2: 1
3: 47
4: 884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998136539 Original CRISPR GACCGCGGCTGGCGGGGCGG CGG Intronic