ID: 998138458

View in Genome Browser
Species Human (GRCh38)
Location 5:139686967-139686989
Sequence CCTGAGGCCCAGTCTGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998138449_998138458 -5 Left 998138449 5:139686949-139686971 CCTGTGCCCTCGCATGGCCCTGA No data
Right 998138458 5:139686967-139686989 CCTGAGGCCCAGTCTGGATGGGG No data
998138444_998138458 11 Left 998138444 5:139686933-139686955 CCCCTCTCACCTGCAGCCTGTGC No data
Right 998138458 5:139686967-139686989 CCTGAGGCCCAGTCTGGATGGGG No data
998138445_998138458 10 Left 998138445 5:139686934-139686956 CCCTCTCACCTGCAGCCTGTGCC No data
Right 998138458 5:139686967-139686989 CCTGAGGCCCAGTCTGGATGGGG No data
998138446_998138458 9 Left 998138446 5:139686935-139686957 CCTCTCACCTGCAGCCTGTGCCC No data
Right 998138458 5:139686967-139686989 CCTGAGGCCCAGTCTGGATGGGG No data
998138447_998138458 2 Left 998138447 5:139686942-139686964 CCTGCAGCCTGTGCCCTCGCATG No data
Right 998138458 5:139686967-139686989 CCTGAGGCCCAGTCTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998138458 Original CRISPR CCTGAGGCCCAGTCTGGATG GGG Intergenic
No off target data available for this crispr