ID: 998139093

View in Genome Browser
Species Human (GRCh38)
Location 5:139689958-139689980
Sequence CTCGCTCCCTGCCCTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998139080_998139093 22 Left 998139080 5:139689913-139689935 CCAGGCCTGGCGGGGCCCCGCGA No data
Right 998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG No data
998139077_998139093 29 Left 998139077 5:139689906-139689928 CCACCTCCCAGGCCTGGCGGGGC No data
Right 998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG No data
998139079_998139093 23 Left 998139079 5:139689912-139689934 CCCAGGCCTGGCGGGGCCCCGCG No data
Right 998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG No data
998139083_998139093 7 Left 998139083 5:139689928-139689950 CCCCGCGAGACAGGTCCTGCCAC No data
Right 998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG No data
998139085_998139093 5 Left 998139085 5:139689930-139689952 CCGCGAGACAGGTCCTGCCACTG No data
Right 998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG No data
998139087_998139093 -8 Left 998139087 5:139689943-139689965 CCTGCCACTGGCTGCCTCGCTCC No data
Right 998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG No data
998139081_998139093 17 Left 998139081 5:139689918-139689940 CCTGGCGGGGCCCCGCGAGACAG No data
Right 998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG No data
998139078_998139093 26 Left 998139078 5:139689909-139689931 CCTCCCAGGCCTGGCGGGGCCCC No data
Right 998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG No data
998139084_998139093 6 Left 998139084 5:139689929-139689951 CCCGCGAGACAGGTCCTGCCACT No data
Right 998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998139093 Original CRISPR CTCGCTCCCTGCCCTCCTGG GGG Intergenic
No off target data available for this crispr