ID: 998140525

View in Genome Browser
Species Human (GRCh38)
Location 5:139697280-139697302
Sequence CTGCAGTCACAGTGAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998140519_998140525 22 Left 998140519 5:139697235-139697257 CCTGCGCCCACGGTGTCGGCACG No data
Right 998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG No data
998140517_998140525 29 Left 998140517 5:139697228-139697250 CCTGGGGCCTGCGCCCACGGTGT No data
Right 998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG No data
998140516_998140525 30 Left 998140516 5:139697227-139697249 CCCTGGGGCCTGCGCCCACGGTG No data
Right 998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG No data
998140521_998140525 15 Left 998140521 5:139697242-139697264 CCACGGTGTCGGCACGCGATGAG No data
Right 998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG No data
998140520_998140525 16 Left 998140520 5:139697241-139697263 CCCACGGTGTCGGCACGCGATGA No data
Right 998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998140525 Original CRISPR CTGCAGTCACAGTGAGAGCA GGG Intergenic
No off target data available for this crispr