ID: 998141249

View in Genome Browser
Species Human (GRCh38)
Location 5:139700841-139700863
Sequence AGGCATGGCTGGTCAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141249_998141263 26 Left 998141249 5:139700841-139700863 CCCTCTCCTGACCAGCCATGCCT No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141249_998141257 9 Left 998141249 5:139700841-139700863 CCCTCTCCTGACCAGCCATGCCT No data
Right 998141257 5:139700873-139700895 GGCCCAGCTACTCTCCTCCAGGG No data
998141249_998141256 8 Left 998141249 5:139700841-139700863 CCCTCTCCTGACCAGCCATGCCT No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141249_998141260 15 Left 998141249 5:139700841-139700863 CCCTCTCCTGACCAGCCATGCCT No data
Right 998141260 5:139700879-139700901 GCTACTCTCCTCCAGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141249 Original CRISPR AGGCATGGCTGGTCAGGAGA GGG (reversed) Intergenic