ID: 998141250

View in Genome Browser
Species Human (GRCh38)
Location 5:139700842-139700864
Sequence CAGGCATGGCTGGTCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141250_998141260 14 Left 998141250 5:139700842-139700864 CCTCTCCTGACCAGCCATGCCTG No data
Right 998141260 5:139700879-139700901 GCTACTCTCCTCCAGGGCGCTGG No data
998141250_998141263 25 Left 998141250 5:139700842-139700864 CCTCTCCTGACCAGCCATGCCTG No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141250_998141256 7 Left 998141250 5:139700842-139700864 CCTCTCCTGACCAGCCATGCCTG No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141250_998141257 8 Left 998141250 5:139700842-139700864 CCTCTCCTGACCAGCCATGCCTG No data
Right 998141257 5:139700873-139700895 GGCCCAGCTACTCTCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141250 Original CRISPR CAGGCATGGCTGGTCAGGAG AGG (reversed) Intergenic