ID: 998141251

View in Genome Browser
Species Human (GRCh38)
Location 5:139700847-139700869
Sequence AAACACAGGCATGGCTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141251_998141257 3 Left 998141251 5:139700847-139700869 CCTGACCAGCCATGCCTGTGTTT No data
Right 998141257 5:139700873-139700895 GGCCCAGCTACTCTCCTCCAGGG No data
998141251_998141256 2 Left 998141251 5:139700847-139700869 CCTGACCAGCCATGCCTGTGTTT No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141251_998141263 20 Left 998141251 5:139700847-139700869 CCTGACCAGCCATGCCTGTGTTT No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141251_998141260 9 Left 998141251 5:139700847-139700869 CCTGACCAGCCATGCCTGTGTTT No data
Right 998141260 5:139700879-139700901 GCTACTCTCCTCCAGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141251 Original CRISPR AAACACAGGCATGGCTGGTC AGG (reversed) Intergenic