ID: 998141252

View in Genome Browser
Species Human (GRCh38)
Location 5:139700852-139700874
Sequence CCTCAAAACACAGGCATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141252_998141260 4 Left 998141252 5:139700852-139700874 CCAGCCATGCCTGTGTTTTGAGG No data
Right 998141260 5:139700879-139700901 GCTACTCTCCTCCAGGGCGCTGG No data
998141252_998141256 -3 Left 998141252 5:139700852-139700874 CCAGCCATGCCTGTGTTTTGAGG No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141252_998141263 15 Left 998141252 5:139700852-139700874 CCAGCCATGCCTGTGTTTTGAGG No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141252_998141257 -2 Left 998141252 5:139700852-139700874 CCAGCCATGCCTGTGTTTTGAGG No data
Right 998141257 5:139700873-139700895 GGCCCAGCTACTCTCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141252 Original CRISPR CCTCAAAACACAGGCATGGC TGG (reversed) Intergenic