ID: 998141254

View in Genome Browser
Species Human (GRCh38)
Location 5:139700856-139700878
Sequence TGGGCCTCAAAACACAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141254_998141263 11 Left 998141254 5:139700856-139700878 CCATGCCTGTGTTTTGAGGCCCA No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141254_998141256 -7 Left 998141254 5:139700856-139700878 CCATGCCTGTGTTTTGAGGCCCA No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141254_998141260 0 Left 998141254 5:139700856-139700878 CCATGCCTGTGTTTTGAGGCCCA No data
Right 998141260 5:139700879-139700901 GCTACTCTCCTCCAGGGCGCTGG No data
998141254_998141257 -6 Left 998141254 5:139700856-139700878 CCATGCCTGTGTTTTGAGGCCCA No data
Right 998141257 5:139700873-139700895 GGCCCAGCTACTCTCCTCCAGGG No data
998141254_998141265 27 Left 998141254 5:139700856-139700878 CCATGCCTGTGTTTTGAGGCCCA No data
Right 998141265 5:139700906-139700928 CATGCGGTACCCTCCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141254 Original CRISPR TGGGCCTCAAAACACAGGCA TGG (reversed) Intergenic