ID: 998141255

View in Genome Browser
Species Human (GRCh38)
Location 5:139700861-139700883
Sequence GTAGCTGGGCCTCAAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141255_998141265 22 Left 998141255 5:139700861-139700883 CCTGTGTTTTGAGGCCCAGCTAC No data
Right 998141265 5:139700906-139700928 CATGCGGTACCCTCCTCTTTTGG No data
998141255_998141260 -5 Left 998141255 5:139700861-139700883 CCTGTGTTTTGAGGCCCAGCTAC No data
Right 998141260 5:139700879-139700901 GCTACTCTCCTCCAGGGCGCTGG No data
998141255_998141263 6 Left 998141255 5:139700861-139700883 CCTGTGTTTTGAGGCCCAGCTAC No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141255 Original CRISPR GTAGCTGGGCCTCAAAACAC AGG (reversed) Intergenic