ID: 998141256

View in Genome Browser
Species Human (GRCh38)
Location 5:139700872-139700894
Sequence AGGCCCAGCTACTCTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141252_998141256 -3 Left 998141252 5:139700852-139700874 CCAGCCATGCCTGTGTTTTGAGG No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141254_998141256 -7 Left 998141254 5:139700856-139700878 CCATGCCTGTGTTTTGAGGCCCA No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141251_998141256 2 Left 998141251 5:139700847-139700869 CCTGACCAGCCATGCCTGTGTTT No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141248_998141256 15 Left 998141248 5:139700834-139700856 CCTCTTGCCCTCTCCTGACCAGC No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141249_998141256 8 Left 998141249 5:139700841-139700863 CCCTCTCCTGACCAGCCATGCCT No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141250_998141256 7 Left 998141250 5:139700842-139700864 CCTCTCCTGACCAGCCATGCCTG No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data
998141247_998141256 19 Left 998141247 5:139700830-139700852 CCTTCCTCTTGCCCTCTCCTGAC No data
Right 998141256 5:139700872-139700894 AGGCCCAGCTACTCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141256 Original CRISPR AGGCCCAGCTACTCTCCTCC AGG Intergenic