ID: 998141259

View in Genome Browser
Species Human (GRCh38)
Location 5:139700876-139700898
Sequence GCGCCCTGGAGGAGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141259_998141269 21 Left 998141259 5:139700876-139700898 CCAGCTACTCTCCTCCAGGGCGC No data
Right 998141269 5:139700920-139700942 CTCTTTTGGCCCCACCCTCCTGG No data
998141259_998141263 -9 Left 998141259 5:139700876-139700898 CCAGCTACTCTCCTCCAGGGCGC No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141259_998141265 7 Left 998141259 5:139700876-139700898 CCAGCTACTCTCCTCCAGGGCGC No data
Right 998141265 5:139700906-139700928 CATGCGGTACCCTCCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141259 Original CRISPR GCGCCCTGGAGGAGAGTAGC TGG (reversed) Intergenic