ID: 998141263

View in Genome Browser
Species Human (GRCh38)
Location 5:139700890-139700912
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141254_998141263 11 Left 998141254 5:139700856-139700878 CCATGCCTGTGTTTTGAGGCCCA No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141252_998141263 15 Left 998141252 5:139700852-139700874 CCAGCCATGCCTGTGTTTTGAGG No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141255_998141263 6 Left 998141255 5:139700861-139700883 CCTGTGTTTTGAGGCCCAGCTAC No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141259_998141263 -9 Left 998141259 5:139700876-139700898 CCAGCTACTCTCCTCCAGGGCGC No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141251_998141263 20 Left 998141251 5:139700847-139700869 CCTGACCAGCCATGCCTGTGTTT No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141250_998141263 25 Left 998141250 5:139700842-139700864 CCTCTCCTGACCAGCCATGCCTG No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141249_998141263 26 Left 998141249 5:139700841-139700863 CCCTCTCCTGACCAGCCATGCCT No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
998141258_998141263 -8 Left 998141258 5:139700875-139700897 CCCAGCTACTCTCCTCCAGGGCG No data
Right 998141263 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type