ID: 998141265

View in Genome Browser
Species Human (GRCh38)
Location 5:139700906-139700928
Sequence CATGCGGTACCCTCCTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141259_998141265 7 Left 998141259 5:139700876-139700898 CCAGCTACTCTCCTCCAGGGCGC No data
Right 998141265 5:139700906-139700928 CATGCGGTACCCTCCTCTTTTGG No data
998141255_998141265 22 Left 998141255 5:139700861-139700883 CCTGTGTTTTGAGGCCCAGCTAC No data
Right 998141265 5:139700906-139700928 CATGCGGTACCCTCCTCTTTTGG No data
998141262_998141265 -7 Left 998141262 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
Right 998141265 5:139700906-139700928 CATGCGGTACCCTCCTCTTTTGG No data
998141261_998141265 -4 Left 998141261 5:139700887-139700909 CCTCCAGGGCGCTGGCTTCCATG No data
Right 998141265 5:139700906-139700928 CATGCGGTACCCTCCTCTTTTGG No data
998141254_998141265 27 Left 998141254 5:139700856-139700878 CCATGCCTGTGTTTTGAGGCCCA No data
Right 998141265 5:139700906-139700928 CATGCGGTACCCTCCTCTTTTGG No data
998141258_998141265 8 Left 998141258 5:139700875-139700897 CCCAGCTACTCTCCTCCAGGGCG No data
Right 998141265 5:139700906-139700928 CATGCGGTACCCTCCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141265 Original CRISPR CATGCGGTACCCTCCTCTTT TGG Intergenic