ID: 998141269

View in Genome Browser
Species Human (GRCh38)
Location 5:139700920-139700942
Sequence CTCTTTTGGCCCCACCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998141264_998141269 -8 Left 998141264 5:139700905-139700927 CCATGCGGTACCCTCCTCTTTTG No data
Right 998141269 5:139700920-139700942 CTCTTTTGGCCCCACCCTCCTGG No data
998141258_998141269 22 Left 998141258 5:139700875-139700897 CCCAGCTACTCTCCTCCAGGGCG No data
Right 998141269 5:139700920-139700942 CTCTTTTGGCCCCACCCTCCTGG No data
998141261_998141269 10 Left 998141261 5:139700887-139700909 CCTCCAGGGCGCTGGCTTCCATG No data
Right 998141269 5:139700920-139700942 CTCTTTTGGCCCCACCCTCCTGG No data
998141262_998141269 7 Left 998141262 5:139700890-139700912 CCAGGGCGCTGGCTTCCATGCGG No data
Right 998141269 5:139700920-139700942 CTCTTTTGGCCCCACCCTCCTGG No data
998141259_998141269 21 Left 998141259 5:139700876-139700898 CCAGCTACTCTCCTCCAGGGCGC No data
Right 998141269 5:139700920-139700942 CTCTTTTGGCCCCACCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998141269 Original CRISPR CTCTTTTGGCCCCACCCTCC TGG Intergenic