ID: 998143248

View in Genome Browser
Species Human (GRCh38)
Location 5:139711409-139711431
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998143241_998143248 14 Left 998143241 5:139711372-139711394 CCCGGGATCGAAAATAATTTGGG No data
Right 998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG No data
998143243_998143248 13 Left 998143243 5:139711373-139711395 CCGGGATCGAAAATAATTTGGGC No data
Right 998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG No data
998143239_998143248 23 Left 998143239 5:139711363-139711385 CCGGAGTCTCCCGGGATCGAAAA No data
Right 998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr