ID: 998143405

View in Genome Browser
Species Human (GRCh38)
Location 5:139712120-139712142
Sequence TGCCGCAGGGGGGTGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998143393_998143405 -9 Left 998143393 5:139712106-139712128 CCTGCCAAGCTGCCTGCCGCAGG No data
Right 998143405 5:139712120-139712142 TGCCGCAGGGGGGTGGGGATGGG No data
998143392_998143405 -8 Left 998143392 5:139712105-139712127 CCCTGCCAAGCTGCCTGCCGCAG No data
Right 998143405 5:139712120-139712142 TGCCGCAGGGGGGTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998143405 Original CRISPR TGCCGCAGGGGGGTGGGGAT GGG Intergenic
No off target data available for this crispr