ID: 998147031

View in Genome Browser
Species Human (GRCh38)
Location 5:139734796-139734818
Sequence CTGGATCAGCAGAGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998147031_998147038 14 Left 998147031 5:139734796-139734818 CCTGCCTGCCTCTGCTGATCCAG No data
Right 998147038 5:139734833-139734855 TATCCCTGTCTTTCCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998147031 Original CRISPR CTGGATCAGCAGAGGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr