ID: 998150014

View in Genome Browser
Species Human (GRCh38)
Location 5:139751438-139751460
Sequence CTGTGTGAGTATGTGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998150014_998150024 14 Left 998150014 5:139751438-139751460 CCCACCTACACATACTCACACAG No data
Right 998150024 5:139751475-139751497 CCCTTCAAGTGTGACCAACTGGG No data
998150014_998150028 24 Left 998150014 5:139751438-139751460 CCCACCTACACATACTCACACAG No data
Right 998150028 5:139751485-139751507 GTGACCAACTGGGAACCCTGGGG No data
998150014_998150027 23 Left 998150014 5:139751438-139751460 CCCACCTACACATACTCACACAG No data
Right 998150027 5:139751484-139751506 TGTGACCAACTGGGAACCCTGGG No data
998150014_998150022 13 Left 998150014 5:139751438-139751460 CCCACCTACACATACTCACACAG No data
Right 998150022 5:139751474-139751496 CCCCTTCAAGTGTGACCAACTGG No data
998150014_998150026 22 Left 998150014 5:139751438-139751460 CCCACCTACACATACTCACACAG No data
Right 998150026 5:139751483-139751505 GTGTGACCAACTGGGAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998150014 Original CRISPR CTGTGTGAGTATGTGTAGGT GGG (reversed) Intergenic
No off target data available for this crispr