ID: 998152299

View in Genome Browser
Species Human (GRCh38)
Location 5:139764447-139764469
Sequence TCCGTGTCCCGGGGGTCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998152285_998152299 21 Left 998152285 5:139764403-139764425 CCTGGGAGTGTGAGTGAGGGGCG No data
Right 998152299 5:139764447-139764469 TCCGTGTCCCGGGGGTCTGGCGG No data
998152279_998152299 30 Left 998152279 5:139764394-139764416 CCGTGTGCCCCTGGGAGTGTGAG No data
Right 998152299 5:139764447-139764469 TCCGTGTCCCGGGGGTCTGGCGG No data
998152282_998152299 23 Left 998152282 5:139764401-139764423 CCCCTGGGAGTGTGAGTGAGGGG No data
Right 998152299 5:139764447-139764469 TCCGTGTCCCGGGGGTCTGGCGG No data
998152284_998152299 22 Left 998152284 5:139764402-139764424 CCCTGGGAGTGTGAGTGAGGGGC No data
Right 998152299 5:139764447-139764469 TCCGTGTCCCGGGGGTCTGGCGG No data
998152292_998152299 -2 Left 998152292 5:139764426-139764448 CCTGTGGGTGGGGGAGCCATATC No data
Right 998152299 5:139764447-139764469 TCCGTGTCCCGGGGGTCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998152299 Original CRISPR TCCGTGTCCCGGGGGTCTGG CGG Intergenic
No off target data available for this crispr