ID: 998152782

View in Genome Browser
Species Human (GRCh38)
Location 5:139766487-139766509
Sequence CTGTGTATGGGGGAAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998152768_998152782 13 Left 998152768 5:139766451-139766473 CCTCTCCCTGTCCCACAATATGG No data
Right 998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG No data
998152767_998152782 14 Left 998152767 5:139766450-139766472 CCCTCTCCCTGTCCCACAATATG No data
Right 998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG No data
998152775_998152782 1 Left 998152775 5:139766463-139766485 CCACAATATGGGGTTTTCTCTCC No data
Right 998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG No data
998152773_998152782 7 Left 998152773 5:139766457-139766479 CCTGTCCCACAATATGGGGTTTT No data
Right 998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG No data
998152772_998152782 8 Left 998152772 5:139766456-139766478 CCCTGTCCCACAATATGGGGTTT No data
Right 998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG No data
998152774_998152782 2 Left 998152774 5:139766462-139766484 CCCACAATATGGGGTTTTCTCTC No data
Right 998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998152782 Original CRISPR CTGTGTATGGGGGAAATGGA TGG Intergenic
No off target data available for this crispr