ID: 998153532

View in Genome Browser
Species Human (GRCh38)
Location 5:139771213-139771235
Sequence AAATAGAGACTCCGCCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998153532_998153539 1 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153539 5:139771237-139771259 AGGGTGAGGAATTGCGGGCCTGG No data
998153532_998153537 -5 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153537 5:139771231-139771253 TATTTTAGGGTGAGGAATTGCGG No data
998153532_998153538 -4 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153538 5:139771232-139771254 ATTTTAGGGTGAGGAATTGCGGG No data
998153532_998153542 9 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153542 5:139771245-139771267 GAATTGCGGGCCTGGGGACCCGG No data
998153532_998153548 27 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153548 5:139771263-139771285 CCCGGGGCTGCCCCACCCCTGGG No data
998153532_998153540 2 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153540 5:139771238-139771260 GGGTGAGGAATTGCGGGCCTGGG No data
998153532_998153544 11 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153544 5:139771247-139771269 ATTGCGGGCCTGGGGACCCGGGG No data
998153532_998153543 10 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153543 5:139771246-139771268 AATTGCGGGCCTGGGGACCCGGG No data
998153532_998153541 3 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153541 5:139771239-139771261 GGTGAGGAATTGCGGGCCTGGGG No data
998153532_998153546 26 Left 998153532 5:139771213-139771235 CCCGGGTGGCGGAGTCTCTATTT No data
Right 998153546 5:139771262-139771284 ACCCGGGGCTGCCCCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998153532 Original CRISPR AAATAGAGACTCCGCCACCC GGG (reversed) Intergenic
No off target data available for this crispr