ID: 998154591

View in Genome Browser
Species Human (GRCh38)
Location 5:139777351-139777373
Sequence TGGCATCTGTTTGCAACAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998154591_998154593 -1 Left 998154591 5:139777351-139777373 CCTCTTGTTGCAAACAGATGCCA No data
Right 998154593 5:139777373-139777395 AATGTGTGCATTAAAGTGAGAGG No data
998154591_998154594 25 Left 998154591 5:139777351-139777373 CCTCTTGTTGCAAACAGATGCCA No data
Right 998154594 5:139777399-139777421 AAGCAAGACTATTTCAAAGCTGG No data
998154591_998154595 28 Left 998154591 5:139777351-139777373 CCTCTTGTTGCAAACAGATGCCA No data
Right 998154595 5:139777402-139777424 CAAGACTATTTCAAAGCTGGTGG No data
998154591_998154596 29 Left 998154591 5:139777351-139777373 CCTCTTGTTGCAAACAGATGCCA No data
Right 998154596 5:139777403-139777425 AAGACTATTTCAAAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998154591 Original CRISPR TGGCATCTGTTTGCAACAAG AGG (reversed) Intergenic
No off target data available for this crispr