ID: 998161917

View in Genome Browser
Species Human (GRCh38)
Location 5:139817778-139817800
Sequence TTGTGACTCTAGGAGAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 1, 2: 0, 3: 32, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998161908_998161917 20 Left 998161908 5:139817735-139817757 CCCACTTTGTAGTAGCTGTTAGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 998161917 5:139817778-139817800 TTGTGACTCTAGGAGAGGAAGGG 0: 1
1: 1
2: 0
3: 32
4: 252
998161910_998161917 19 Left 998161910 5:139817736-139817758 CCACTTTGTAGTAGCTGTTAGGA 0: 1
1: 0
2: 0
3: 7
4: 109
Right 998161917 5:139817778-139817800 TTGTGACTCTAGGAGAGGAAGGG 0: 1
1: 1
2: 0
3: 32
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998161917 Original CRISPR TTGTGACTCTAGGAGAGGAA GGG Intronic
901168446 1:7236454-7236476 TTGTGACTGTAGAAGGGGAGGGG + Intronic
902256207 1:15190256-15190278 TTGTGACTCTAGCATGGGATTGG + Intronic
902466360 1:16620997-16621019 TTGTGATTTTAGGAGAGATAGGG + Intergenic
904171419 1:28594112-28594134 TGTTGACTCTAGGAGAGAAAGGG + Exonic
904207324 1:28863553-28863575 CAGTGACTCCAGGAGAGGAGCGG + Exonic
904673940 1:32186291-32186313 GTGTGACTGGAGGAGAGGACGGG + Intronic
904839078 1:33359445-33359467 ATGTGCCTGTGGGAGAGGAATGG + Intronic
905330430 1:37191439-37191461 TTGTGGTCCAAGGAGAGGAAAGG + Intergenic
905467452 1:38166199-38166221 TTGTGAAGCTAAGACAGGAAGGG + Intergenic
906239434 1:44233356-44233378 TTGTGACAGGAGGAGAGGACTGG - Intronic
906381198 1:45333076-45333098 AGGTGACTCCAGGGGAGGAAGGG - Exonic
906705017 1:47888399-47888421 TTGGGACCCTGGGAGAGGAGTGG + Intronic
906934907 1:50205907-50205929 TAGTGACTCAAGGAGAGTATGGG - Intergenic
906951753 1:50340708-50340730 CTGTGATTCTAGAAGAGGGATGG - Intergenic
907867071 1:58408688-58408710 TTTTGACTCTTGGAGATGGAAGG + Intronic
909682268 1:78305414-78305436 TGGTTACTTTGGGAGAGGAAAGG - Intronic
910491023 1:87770998-87771020 TTATGACCTTAGGATAGGAAAGG + Intergenic
910608730 1:89116183-89116205 TTGTGTTTTTAGTAGAGGAAGGG + Intronic
911248236 1:95543671-95543693 TTGTGACTTTAGAATAGGTACGG - Intergenic
911876276 1:103167332-103167354 TTGTGATTTTAGGAGGAGAAAGG - Intergenic
912111968 1:106354457-106354479 TTTAGACTATAGGAGAGCAAAGG + Intergenic
915167555 1:153956928-153956950 CTGTGATTCTAGCAGAGGCATGG - Intronic
915540288 1:156561782-156561804 ATGTGACTATAGGATAGGAGAGG - Intronic
916396180 1:164389997-164390019 TTGGGAAAATAGGAGAGGAAGGG - Intergenic
918117558 1:181509997-181510019 TTGTGAGCCCAGGAGAGCAATGG + Intronic
918372606 1:183876189-183876211 TTGTGACTCTGGGAAATAAAGGG + Intronic
920093796 1:203472623-203472645 CTGAGACTCTAGGAGAGTAGAGG + Intergenic
920304504 1:205009954-205009976 TGGTGAGTCAAGGGGAGGAAAGG - Intronic
921948426 1:220905019-220905041 AGGTGGCCCTAGGAGAGGAAGGG - Intergenic
922052987 1:222012045-222012067 TTGTCACTCTAGTACAGGGAGGG + Intergenic
1063771982 10:9214139-9214161 GTGGGAACCTAGGAGAGGAATGG - Intergenic
1064941986 10:20745494-20745516 TTGTGGATCTAGGAGAGCAAGGG + Intergenic
1066205717 10:33187490-33187512 TTCTGGCTCAAGGAGAGGCAAGG + Intronic
1066524924 10:36267164-36267186 TTGTAAGTCCAGGAGAGAAAAGG - Intergenic
1066563357 10:36693196-36693218 TTATAAATATAGGAGAGGAAAGG + Intergenic
1069237030 10:66089143-66089165 TTGTGACTTTAGGATGGTAAAGG - Intronic
1069864627 10:71494352-71494374 ATGTGACTCCAGCAGAGGGAAGG + Intronic
1070745607 10:78931903-78931925 TTTTGACTCCAGAAGAGGGATGG + Intergenic
1071367764 10:84917491-84917513 GTGTGAGTCTAGGAGAGGTGGGG + Intergenic
1072370459 10:94761457-94761479 TTGTGAATCTAATAGAGGATGGG - Intronic
1073726899 10:106243057-106243079 TTGTTAAGCTAGGAGAGTAAGGG + Intergenic
1076063351 10:127430061-127430083 TTGTGACTGTAGGTGGGGAGGGG - Intronic
1078056954 11:8016895-8016917 TTGTTTCTCAACGAGAGGAATGG + Intergenic
1078256764 11:9664660-9664682 CTCTTACTCCAGGAGAGGAAGGG + Intronic
1080185815 11:29484376-29484398 TTGGGGCACTTGGAGAGGAAAGG - Intergenic
1080639652 11:34151418-34151440 CTGTGACTCTTGGAGATTAAAGG - Exonic
1080853367 11:36090760-36090782 CTGTGTCTGTAGGAGAGGAAAGG - Intronic
1081047416 11:38294150-38294172 TTGTTACTTTAATAGAGGAATGG - Intergenic
1081546077 11:44072797-44072819 GTGTGGCTCTAAGGGAGGAAGGG + Intronic
1081566759 11:44265176-44265198 TTCTGAATCTGGGAGAGGAAGGG + Exonic
1082303476 11:50540924-50540946 TTGGGACTCATTGAGAGGAATGG - Intergenic
1084486064 11:69449051-69449073 TTGTGGCTCTTGGAAAGGACAGG + Intergenic
1085455870 11:76665101-76665123 TTGTGACTCTATGAGATACAGGG - Intronic
1086368211 11:86129941-86129963 TTCTGACTGTAGGAGTGGTAGGG + Intergenic
1090157606 11:124458167-124458189 TTGAAACTCTAGGACAGGCAGGG - Intergenic
1090842088 11:130499121-130499143 TTCTGCTTCCAGGAGAGGAAGGG - Intergenic
1091603039 12:1929530-1929552 GTGTGACTCAGGCAGAGGAAGGG - Intergenic
1092108821 12:5944950-5944972 TTTTAACTCAAGGAGAGGGAAGG - Intronic
1092522210 12:9286828-9286850 GTGTCACTCTACGAGGGGAAAGG - Intergenic
1092545073 12:9445030-9445052 GTGTCACTCTACGAGGGGAAAGG + Intergenic
1093247935 12:16762942-16762964 TAGCGACTCTAGGAGATGACAGG - Intergenic
1095202938 12:39406739-39406761 TTGTGGCAGTAGGAGAGAAAAGG - Intronic
1095688604 12:45063285-45063307 ATGTGACTCGAGGAGAAGGAAGG + Intergenic
1097679832 12:62638014-62638036 TTGTGACTCCAGCAGAGCAGAGG + Intergenic
1098483614 12:70995409-70995431 CTGTGACTCTAGGAGATTACTGG + Intergenic
1102456436 12:113073643-113073665 TTGTGATTCTAACAGAGGAGAGG + Intronic
1103498867 12:121384930-121384952 TTGTGACTCTAGAAGGTGTAAGG + Intronic
1103687619 12:122744493-122744515 TTGTGTTTTTAGGAGAGAAAGGG - Intergenic
1104655852 12:130573606-130573628 ATGTGACTCTAGGACAGGGCAGG + Intronic
1104938903 12:132385585-132385607 CTGTGACTCCAGGTGAGTAACGG - Intergenic
1104969039 12:132522918-132522940 TTGTCACTCTAGGGGGGGCAGGG + Intronic
1105348648 13:19596920-19596942 TTGTGAGGATAGGAGAGGAAGGG + Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1105698405 13:22914355-22914377 TTCTCTCTCTAGGAGTGGAATGG - Intergenic
1105850064 13:24326594-24326616 TTCTCTCTCTAGGAGTGGAATGG - Intergenic
1106689530 13:32099055-32099077 TTGTGAGTGGAGGAGAGGATTGG + Intronic
1106946439 13:34832865-34832887 TTTGCACCCTAGGAGAGGAATGG - Intergenic
1107395081 13:40007063-40007085 TTGTGAGATGAGGAGAGGAAAGG + Intergenic
1107419649 13:40234513-40234535 TTGTTGCCCTGGGAGAGGAAGGG + Intergenic
1107481037 13:40786511-40786533 TTGTCAGGATAGGAGAGGAAGGG + Intergenic
1107541697 13:41394871-41394893 TTGTGTCTTCAGGAGTGGAATGG + Intergenic
1108582539 13:51839335-51839357 TAAAGACACTAGGAGAGGAAGGG + Intergenic
1108623769 13:52208373-52208395 TTGTGAGGACAGGAGAGGAAGGG + Intergenic
1110083980 13:71354230-71354252 TTTTTACTTTTGGAGAGGAAAGG + Intergenic
1111588558 13:90312833-90312855 TTGTGTGGCTGGGAGAGGAAAGG - Intergenic
1112186589 13:97133713-97133735 TTGTGATTATAGGAGACCAAGGG - Intergenic
1112817219 13:103287014-103287036 TAGTGACTCTTGGAGAAAAAAGG - Intergenic
1113250935 13:108451447-108451469 TTTTGATTCTAGGAGAGGGCAGG - Intergenic
1114298411 14:21351600-21351622 CTGTGACTTTAAGAGAAGAAGGG - Exonic
1116491029 14:45503356-45503378 ATGTGACTCAAGGAGAAGGAAGG - Intergenic
1119840157 14:77786416-77786438 TTGTGAGGCTAAGAGAGAAAAGG - Intergenic
1120935595 14:89892439-89892461 TGTTGACTCTAGGAGAGAAAGGG + Intronic
1123831613 15:24145062-24145084 TTGTGTTTTTAGGAGAGGCAGGG + Intergenic
1124213289 15:27781966-27781988 GTGTGTCTCTAGCACAGGAATGG - Intronic
1124559256 15:30756790-30756812 TTGTGTCTGTAGGAGAGACAGGG - Intronic
1125832839 15:42728732-42728754 TGGTGACACAGGGAGAGGAAGGG - Exonic
1126443456 15:48716976-48716998 TTGATACTCTAGGAGGGGAGGGG - Intronic
1128199538 15:65792551-65792573 TTGTGCCTCTGGGTGACGAAAGG - Intronic
1128292251 15:66486828-66486850 CAGTGACTCTAGGAGACAAAAGG + Intronic
1130209969 15:81914008-81914030 TCGTGCCTCTAGGAGAGAAGAGG - Intergenic
1130469730 15:84215718-84215740 TTGAGCCTCTAGGAAAGGAAAGG + Intergenic
1130477218 15:84330280-84330302 TTGAGCCTCTAGGAAAGGAAAGG + Intergenic
1130494547 15:84457850-84457872 TTGAGCCTCTAGGAAAGGAAAGG - Intergenic
1130592020 15:85220346-85220368 TTGAGCCTCTAGGAAAGGAAAGG + Intergenic
1132888697 16:2194026-2194048 CTGTGACTCTATGACAGTAAAGG + Intronic
1133956306 16:10446905-10446927 TTGAGGCTATAGGAAAGGAAAGG - Intronic
1135987876 16:27197438-27197460 TTATGACTCAAGCAGGGGAAGGG - Intergenic
1137393030 16:48097374-48097396 TTGTGACTGTAGAGGAGGGAAGG + Intronic
1138666853 16:58577419-58577441 TTGAGTCTCTAGGAAAGGAGGGG + Intronic
1139326650 16:66157689-66157711 ATCTGACTCTGGGAAAGGAAAGG - Intergenic
1139465759 16:67153249-67153271 TGGTGACACTGGGTGAGGAATGG - Intergenic
1141262177 16:82463893-82463915 TTTTGTCTCTAGGACAGAAAGGG - Intergenic
1141385308 16:83617061-83617083 TGGTAACTCTAGGCTAGGAAGGG - Intronic
1143490916 17:7284773-7284795 TTGTGGCTGGAGTAGAGGAAGGG + Intronic
1143572616 17:7769563-7769585 TTGTAACTTTGGGATAGGAAAGG - Intronic
1144746880 17:17621798-17621820 AGGTGAGTCTAGGAGAGGAAGGG - Intergenic
1146502833 17:33379104-33379126 TAGTGACTGGAGCAGAGGAAAGG + Intronic
1146950036 17:36899618-36899640 CTGTGAAGCTGGGAGAGGAAGGG + Intergenic
1146988323 17:37243491-37243513 TTGCAATTCTAGGAGAGGCAGGG + Exonic
1147242270 17:39098360-39098382 TTGTGACTCTAGGTGAGAACAGG - Intronic
1147626056 17:41900882-41900904 TGGTGACTCTTGGAGAGGGAAGG - Intronic
1147816416 17:43213900-43213922 TTGTGAAGCTAGGGGAGGAAGGG - Intronic
1147929339 17:43967913-43967935 TTCTGCCTCGAGGAGTGGAAAGG + Intronic
1148173094 17:45540116-45540138 GTGAGACTCTAGGAGAGGTATGG - Intergenic
1148276175 17:46305334-46305356 GTGAGACTCTAGGAGAGGTATGG + Intronic
1148298292 17:46522909-46522931 GTGAGACTCTAGGAGAGGTATGG + Intronic
1148362832 17:47027376-47027398 GTGAGACTCTAGGAGAGGTATGG + Intronic
1150002492 17:61450810-61450832 TTGAGACTCCATGAGAGGAATGG + Intergenic
1150404299 17:64887039-64887061 GTGAGACTCTAGGAGAGGTATGG - Intronic
1150783771 17:68145740-68145762 GTAAGACTCTAGGAGAGGTATGG - Intergenic
1150990654 17:70254483-70254505 ATGTGACTGTGGGAGAGGATGGG + Intergenic
1152265365 17:79291029-79291051 CTGGGACTTTGGGAGAGGAAAGG + Intronic
1155108461 18:22690038-22690060 TTGTAACTCTGGGGGAGGGAGGG - Intergenic
1156599985 18:38594494-38594516 TGCTGTCTCTAGGAGAGTAAAGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157436731 18:47676683-47676705 TTGTAAATCTAGGAGAAGACTGG + Intergenic
1157965937 18:52208122-52208144 AGGTGACTGTAGGATAGGAATGG - Intergenic
1158163939 18:54517758-54517780 GTGTGACTCTCGGAGGAGAAGGG + Intergenic
1158482654 18:57835649-57835671 GGGTCACTCTAGAAGAGGAATGG + Intergenic
1159034170 18:63261303-63261325 TTCTTCCTCCAGGAGAGGAAGGG - Intronic
1159783370 18:72685116-72685138 GTGTGACTCTAACAGAGGCATGG - Intergenic
1159842668 18:73417371-73417393 TGTTGTCTCTAGGTGAGGAAGGG - Intergenic
1164360956 19:27509324-27509346 TTTTAACTCTATGAGATGAATGG - Intergenic
1164903476 19:31947789-31947811 TTTTGGCTCTAGAAGAGAAAGGG + Intergenic
1165214518 19:34260895-34260917 TTGTGTTTCTGGGAGAGGATTGG + Intronic
1167226796 19:48249703-48249725 TGGTGACTTTAGGGGAGGACAGG - Intronic
925554663 2:5116799-5116821 AAGGGACTCTAGCAGAGGAAAGG + Intergenic
925582767 2:5428542-5428564 TAGTGACTCTATGAATGGAAAGG - Intergenic
926700114 2:15797848-15797870 TTGTGACTCTAGGAGAGCAAAGG - Intergenic
927163245 2:20290441-20290463 TTGAGACTCAACGACAGGAATGG - Intronic
927969417 2:27295648-27295670 TTGTGGCTCAGGAAGAGGAAGGG + Intronic
929390404 2:41462544-41462566 TTGTGGCTCTTGGAGGGCAAAGG - Intergenic
929547247 2:42863670-42863692 TGGGGACTCAAGGAGAGCAAAGG - Intergenic
929993849 2:46812578-46812600 TTGTGACTCTGGCAGAGAAATGG - Intergenic
931859763 2:66342500-66342522 ATGTGATTCTAGGAGAGCAATGG - Intergenic
935887236 2:107635549-107635571 CTGTGACTCTGGCAGAGGGAGGG - Intergenic
940339188 2:152561748-152561770 TTGTAATTCTAGTAGAGGCAGGG + Intronic
941661674 2:168201765-168201787 TTGTGACTTGGGGTGAGGAAGGG - Intronic
942205994 2:173620501-173620523 TTGGGGCTCTAGGACAGGAGTGG + Intergenic
943360932 2:186918206-186918228 TTGTGACTGTACCAGAGAAATGG + Intergenic
943469085 2:188270524-188270546 TTGTGATTTTAGGAGAGCAGAGG - Intergenic
945336585 2:208599735-208599757 TAGTGAAACTATGAGAGGAAGGG - Intronic
948877102 2:240835410-240835432 TTGTTCTTCTAGCAGAGGAATGG - Intergenic
1169052928 20:2595772-2595794 CTGTGTCTCCAGGAGAGGAGTGG + Intronic
1169170322 20:3459651-3459673 TTGTGACTATAGGGGAGGCTGGG + Intergenic
1170481717 20:16772443-16772465 TTGTAACTTTAGTAGAGAAAGGG + Intergenic
1170736475 20:19017600-19017622 CTGAGCCTCTAGGAGAGGAGGGG - Intergenic
1171056047 20:21908127-21908149 GTGAGGTTCTAGGAGAGGAATGG + Intergenic
1171263603 20:23752822-23752844 ATGTGACTCCAGGAGAGGAGAGG + Intergenic
1172789823 20:37495178-37495200 TTTTGACTCCAGAAAAGGAAAGG - Intronic
1173088976 20:39952161-39952183 GTGTGACCCTAGGAGACGCAGGG + Intergenic
1173812446 20:45964305-45964327 ATGAGACTCCGGGAGAGGAATGG - Intronic
1174185095 20:48700934-48700956 TTCTGTCTCTGGGAAAGGAAGGG - Intronic
1176014258 20:62921066-62921088 TTGTGTCTTTAGTAGAGAAAGGG + Intronic
1181673752 22:24438727-24438749 TTGAGGCCCAAGGAGAGGAATGG - Intronic
1182185727 22:28399792-28399814 TTGTGAGGCTAGGTGAGGCAAGG - Intronic
1182772414 22:32804887-32804909 CCTTGACTCTAGAAGAGGAATGG + Intronic
1182984935 22:34707332-34707354 TTCTGTTTCTAGGAGAGGACTGG + Intergenic
949747137 3:7308190-7308212 TTAGTACTCTAGAAGAGGAAAGG - Intronic
950214256 3:11147173-11147195 TTGAGTCTCAAGAAGAGGAAAGG - Intronic
950370507 3:12525735-12525757 TTGTGATTTTAGTAGAGAAAGGG + Intronic
950384464 3:12646855-12646877 TTGTGATTTTAGTAGAGAAAGGG + Intronic
950743542 3:15068620-15068642 TGGTGACTCTGGCAGGGGAAAGG - Intergenic
951812786 3:26719256-26719278 TTGTTACTCTTTGAGAGGAAAGG - Intergenic
952093632 3:29921981-29922003 CTGTGACTCTAGGAGTTGAGTGG + Intronic
952788558 3:37179189-37179211 TTGCTAATTTAGGAGAGGAAGGG - Intronic
956147449 3:66205401-66205423 TTTTGAGTCTAGGATTGGAATGG + Intronic
956723583 3:72138925-72138947 CTGTGACTCTAGGAGGGGTGGGG - Intergenic
957117293 3:76043045-76043067 TTCTGAGTCTTGGAAAGGAAAGG + Intronic
957383189 3:79461212-79461234 TTGACACTCTAAGAGAAGAAGGG + Intronic
958019088 3:87976915-87976937 TTATTACTCAAGGAGAGGGAAGG + Intergenic
959318102 3:104835246-104835268 TTATAGCTGTAGGAGAGGAAAGG + Intergenic
959716124 3:109434663-109434685 CTGTGATTGTAGGAAAGGAAAGG - Intergenic
961466658 3:127085848-127085870 GTGTGGCTCTAGGACAGGACTGG + Intergenic
961581778 3:127889011-127889033 TTTTGATTCTAGGAGTGGTAAGG - Intergenic
961695624 3:128702280-128702302 TGGAGACTGGAGGAGAGGAAGGG - Intergenic
962153397 3:132917406-132917428 TTATGTCTCTGGCAGAGGAAAGG - Intergenic
962536257 3:136331700-136331722 TTGGAACTCTAGGTAAGGAAGGG + Intronic
963806843 3:149731370-149731392 TTGTGACTCGGGGCAAGGAATGG + Intronic
964289065 3:155155445-155155467 CTGTGACTCTAGGAGGGCAGAGG - Intronic
964930210 3:162010771-162010793 TTGTGACTCTAGCAGTGGGGAGG - Intergenic
965930182 3:174032707-174032729 TTGTGCCCCCAGCAGAGGAAAGG + Intronic
966876884 3:184327449-184327471 GTGAGAGTCTGGGAGAGGAATGG + Intronic
967991979 3:195138336-195138358 TTGTGAGACTAGGAGGGGAGAGG + Intronic
968266412 3:197366878-197366900 TTGCTGCTCGAGGAGAGGAAGGG - Intergenic
970559694 4:17270432-17270454 TTGAGATTAGAGGAGAGGAAAGG - Intergenic
970849779 4:20587431-20587453 TTGCTACTCTTGGAGAGGTAAGG + Intronic
974908833 4:68090600-68090622 TTGTGACTTTAAAAGAGGCAAGG + Exonic
976328383 4:83799213-83799235 TCCTGACTCCATGAGAGGAAAGG - Intergenic
976564125 4:86533954-86533976 TCATGATTCTAGGAGAGTAATGG - Intronic
978074361 4:104510895-104510917 GAGTGACTCTACGAGAGTAAAGG - Intergenic
979221555 4:118231939-118231961 TTGTGACTATTGGGGAGCAAGGG - Intronic
979367711 4:119845354-119845376 TTGTGACTAAAGGAAAAGAATGG - Intergenic
980092118 4:128453943-128453965 TTGTGTGTTTAGGAAAGGAAGGG + Intergenic
981499796 4:145437851-145437873 TTGTGAGGGCAGGAGAGGAAAGG + Intergenic
981527656 4:145722204-145722226 TGGTGAATCTAGGAGAGGGCAGG - Intronic
981818307 4:148856551-148856573 TGGTTACTCGAGGAAAGGAAGGG - Intergenic
982416129 4:155134321-155134343 TTTTGACTGTAGGGGATGAAGGG + Intergenic
983064836 4:163196211-163196233 TTGTGACTCTATCAGGGAAAAGG - Intergenic
984406122 4:179332264-179332286 TTGTGACTTTGAGAGAAGAAAGG - Intergenic
986427482 5:7649171-7649193 TTGTGGTTCTAGGAGATAAAGGG - Intronic
987898335 5:23978212-23978234 TTGAGCCTCTAGGAAAGGAAAGG + Intronic
988798750 5:34676752-34676774 TTGTGAATATAGGAGATGAATGG + Intronic
989224356 5:39009062-39009084 TTATTACTGTAGCAGAGGAATGG - Intronic
989321803 5:40143549-40143571 TTGTTACTTTGGGAGAGGAGTGG - Intergenic
990716662 5:58645078-58645100 TGGAGACACTAGGAAAGGAAAGG + Intronic
993584438 5:89706448-89706470 CTCTGACTATAGGAGAGGAGAGG + Intergenic
998161917 5:139817778-139817800 TTGTGACTCTAGGAGAGGAAGGG + Intronic
998518430 5:142777783-142777805 TTGTGACTGTAGCAGAGTGAAGG + Intronic
999078335 5:148818758-148818780 GTGTGGCTGTAGGACAGGAAGGG - Intergenic
999251709 5:150186351-150186373 CTGTGACTCTATCAGAGGAGTGG - Intergenic
1000039052 5:157471599-157471621 TTGGGACTCTGGGACAGGCATGG + Intronic
1001259059 5:170211242-170211264 TTGTCAAGATAGGAGAGGAAGGG + Intergenic
1002805261 6:567495-567517 TTCTGTCTCTAGAAGAGGAAAGG + Intronic
1003026297 6:2558502-2558524 TTGTGCCTTGAGGAGAGAAATGG + Intergenic
1003845609 6:10171141-10171163 TGGAGCCTCTAAGAGAGGAACGG + Intronic
1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG + Intergenic
1004712335 6:18184146-18184168 TAGTTACTCTAGGGGAGCAAGGG - Intronic
1005834807 6:29700580-29700602 TTGTAACTTTAGTAGAGGCAGGG + Intergenic
1006295411 6:33167914-33167936 GTGTGTGTCTAGGACAGGAAGGG - Intronic
1006835833 6:36998390-36998412 TTGTGTTTCTAGGGGAGGAGAGG - Intergenic
1007056036 6:38885787-38885809 GTGTGACTCAAGGAGAGCAGGGG - Intronic
1009998050 6:70919456-70919478 TTGTGATCCTTGGAGAAGAAAGG + Intronic
1011589836 6:88961783-88961805 GTAAGTCTCTAGGAGAGGAATGG - Intronic
1015735711 6:136397912-136397934 TTGTGACTTCAGAAGAGTAAAGG - Intronic
1018320989 6:162608368-162608390 CTGTGGCTCAAGGACAGGAAAGG + Intronic
1019628491 7:2033636-2033658 TTGCCACTCCAGGTGAGGAACGG - Intronic
1019632986 7:2059482-2059504 TTGTGGCCAGAGGAGAGGAAAGG + Intronic
1021892865 7:25203897-25203919 TTGTGGCTCTAGTAGGAGAAGGG - Intergenic
1022181373 7:27923693-27923715 TTGGCACACTAGGAGAGGACAGG + Intronic
1022974885 7:35547855-35547877 TTGTGAGTTTGGGAAAGGAAGGG - Intergenic
1023182779 7:37502074-37502096 ATATTACTGTAGGAGAGGAATGG - Intergenic
1023789856 7:43745156-43745178 TGGTTTCTCTTGGAGAGGAATGG - Intergenic
1024272567 7:47653754-47653776 GAGAAACTCTAGGAGAGGAAAGG - Intergenic
1024283450 7:47737707-47737729 TTGTGACTGAGGCAGAGGAATGG - Intronic
1026473963 7:70718182-70718204 TTCTGAGTTGAGGAGAGGAAAGG - Intronic
1026576981 7:71580624-71580646 TTGTGACAGTGGGAGAGGAATGG + Intronic
1030040047 7:105441364-105441386 CTGTGATTCTAGGACAGGCATGG - Intronic
1031426431 7:121610944-121610966 TTCTGGCTATAGGAGAGGAAGGG - Intergenic
1032130780 7:129225454-129225476 CTGCCTCTCTAGGAGAGGAAGGG + Intronic
1034211157 7:149364502-149364524 TAGTAACTCTAGCAGAGGATTGG + Intergenic
1034511852 7:151542222-151542244 GTTTGACTGCAGGAGAGGAATGG - Intergenic
1035756124 8:2034259-2034281 TGTTGCCTCCAGGAGAGGAAGGG - Intergenic
1040454640 8:47584300-47584322 TTGTGAGTATATGAGAAGAATGG + Intronic
1043265487 8:78262469-78262491 TTTTGTCACTAGGAGAAGAAGGG - Intergenic
1043579416 8:81694913-81694935 TTGTGACTATAGAAGAAGCAAGG - Exonic
1043829221 8:84968021-84968043 GTGTGACTCTGTGAGAAGAAGGG + Intergenic
1044322489 8:90819898-90819920 TTGTGGCTCTGGCAGGGGAAGGG - Intronic
1045808092 8:106189479-106189501 TTGTGACTGTCAAAGAGGAAAGG - Intergenic
1046953187 8:120037646-120037668 ATGTCACTCTAGCAGAAGAATGG + Intronic
1048661200 8:136603717-136603739 TTTTAACTCTAGGAGAAAAAAGG + Intergenic
1048908426 8:139110879-139110901 TTGTGACTCTAGGCAATGATGGG + Intergenic
1051460738 9:17311634-17311656 TTGTATTTCTAGTAGAGGAAGGG - Intronic
1051961479 9:22769536-22769558 TTGTGGCTCTAGCAGAAGAAGGG - Intergenic
1052735676 9:32340009-32340031 TTTTAATTTTAGGAGAGGAATGG - Intergenic
1053126613 9:35586000-35586022 GTGTGACTCCTGGAGGGGAAAGG - Intergenic
1056453502 9:86738916-86738938 CAGAGACTCTAGGAGCGGAAGGG - Intergenic
1059679521 9:116572437-116572459 AAGGGACTTTAGGAGAGGAATGG + Intronic
1060882078 9:127124223-127124245 TTCTGAGGCTGGGAGAGGAAAGG + Intronic
1203413765 Un_KI270589v1:27755-27777 TTTCGACTCTTGGAGATGAATGG + Intergenic
1203684514 Un_KI270757v1:32123-32145 TTTCGACTCTTGGAGATGAATGG - Intergenic
1185755140 X:2647235-2647257 TGGAGGCTCTAGGAGAGAAACGG + Intergenic
1187692770 X:21887766-21887788 TTGTGACTCTGGGACAGGACAGG - Intergenic
1188558246 X:31436506-31436528 TTCTCACCCTAGGAGAAGAATGG - Intronic
1189037957 X:37512122-37512144 ATGCGACTCCAGGAGAGAAACGG + Intronic
1201322699 Y:12717624-12717646 TTGTGAGTCTAGGTCATGAAAGG - Intronic