ID: 998163758

View in Genome Browser
Species Human (GRCh38)
Location 5:139828658-139828680
Sequence TTTCAGAAGCAGGATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 775}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998163758_998163765 17 Left 998163758 5:139828658-139828680 CCTGCCTCATCCTGCTTCTGAAA 0: 1
1: 0
2: 6
3: 73
4: 775
Right 998163765 5:139828698-139828720 CTAGCATTGTTCTGATCTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 152
998163758_998163764 16 Left 998163758 5:139828658-139828680 CCTGCCTCATCCTGCTTCTGAAA 0: 1
1: 0
2: 6
3: 73
4: 775
Right 998163764 5:139828697-139828719 GCTAGCATTGTTCTGATCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 115
998163758_998163761 -6 Left 998163758 5:139828658-139828680 CCTGCCTCATCCTGCTTCTGAAA 0: 1
1: 0
2: 6
3: 73
4: 775
Right 998163761 5:139828675-139828697 CTGAAATGACCCTTAAAGACAGG 0: 1
1: 1
2: 0
3: 19
4: 155
998163758_998163766 27 Left 998163758 5:139828658-139828680 CCTGCCTCATCCTGCTTCTGAAA 0: 1
1: 0
2: 6
3: 73
4: 775
Right 998163766 5:139828708-139828730 TCTGATCTCAGGGCTGTGCATGG 0: 1
1: 0
2: 4
3: 29
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998163758 Original CRISPR TTTCAGAAGCAGGATGAGGC AGG (reversed) Intronic
900039815 1:449974-449996 TTTCAGAATCAGGGTAATGCTGG - Intergenic
900061247 1:684950-684972 TTTCAGAATCAGGGTAATGCTGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900801758 1:4741363-4741385 TCCCAGAAGCTGGAAGAGGCCGG - Intronic
901110437 1:6789076-6789098 TTGCAGAAGCAGGATAAGTAAGG - Intronic
901246396 1:7735199-7735221 CTTCAGAAGAAGCAAGAGGCTGG + Intronic
901652403 1:10750601-10750623 TTATAGAAGGAGGCTGAGGCTGG + Intronic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
901900460 1:12357388-12357410 TTTCAGGAGAAGAATGAGACTGG - Intronic
902714412 1:18262609-18262631 TTCCAGAAGCGGGATGAGAGAGG + Intronic
904484618 1:30816461-30816483 TTTCTGAACCAGGATGGGGGTGG + Intergenic
904702882 1:32368570-32368592 TGTGAAAAGCAGGAGGAGGCAGG + Intronic
905551987 1:38849293-38849315 ATTAAGCAGAAGGATGAGGCAGG - Intronic
906579245 1:46922153-46922175 TTTTGGAATCAGGATGATGCTGG + Intergenic
906604465 1:47156703-47156725 TTTTGGAATCAGGATGATGCTGG - Intergenic
907390657 1:54156089-54156111 TTTCAGAGGTAGGATGATTCTGG - Intronic
908584279 1:65551202-65551224 TTTTAGTATCAGGATGATGCGGG + Intronic
908710497 1:67008902-67008924 TTTAAGAAGCAGGGAGAGGTTGG - Intronic
908851535 1:68381649-68381671 TTTCTCTGGCAGGATGAGGCGGG - Intergenic
908935993 1:69376147-69376169 TTACACAAGTAGGATGAGGTGGG + Intergenic
909053742 1:70798430-70798452 TTTTGGTATCAGGATGAGGCTGG + Intergenic
909992132 1:82236616-82236638 TTTTAGTATCAGGATGATGCTGG + Intergenic
910082577 1:83358687-83358709 TTTTGGAAACAGGATGATGCTGG + Intergenic
910709538 1:90165492-90165514 TTTCAGAAGCAGGTTGGGGATGG + Intergenic
911108561 1:94158886-94158908 CTTAAGAAGCAAGAAGAGGCTGG - Intronic
911876144 1:103165544-103165566 TTTTGGTATCAGGATGAGGCTGG + Intergenic
912035562 1:105307735-105307757 TTTCAGTATCAGGATGATGCTGG + Intergenic
912164867 1:107031063-107031085 TTTAAGAATGAGGATGAGGGAGG - Intergenic
912595062 1:110867220-110867242 TTTCAGTATTAGGATGATGCTGG - Intergenic
912703519 1:111895632-111895654 ATTCAGCAGCAGGATGAGTCAGG + Intronic
912725038 1:112051308-112051330 TTTAAGAAGGCGGATAAGGCTGG + Intergenic
912732428 1:112120242-112120264 TTTTAGGATCAGGATGATGCTGG - Intergenic
913192543 1:116425987-116426009 CTTCACAAGAAGGATCAGGCAGG - Intergenic
913291840 1:117280744-117280766 TTTCAGAGGGAGGCTGAGGCAGG + Intergenic
913416471 1:118614532-118614554 TCACACAAGCAGGATGACGCTGG - Intergenic
913655520 1:120956121-120956143 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914880345 1:151541546-151541568 CCTCAAGAGCAGGATGAGGCAGG - Intronic
915011410 1:152689862-152689884 TTTTAAAATCAGGATGATGCTGG - Intergenic
915649448 1:157297885-157297907 TTTTAGTATCAGGATGATGCTGG - Intergenic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
915959254 1:160251056-160251078 CTTGAGTAGCAGAATGAGGCAGG - Intronic
916344566 1:163773330-163773352 TTTCAGAAGTAGGGTGAGCTTGG - Intergenic
916346936 1:163803246-163803268 TTTCAGAAGCAAGGCAAGGCTGG - Intergenic
916625223 1:166548611-166548633 TTTCCGCAACAGGATGATGCTGG + Intergenic
916944577 1:169713127-169713149 TTTTAGTATCAGGATGATGCTGG - Intronic
917418390 1:174835632-174835654 TTTTAGAAGCCAGAGGAGGCTGG - Intronic
917768250 1:178247052-178247074 TTTTGGAATCAGGATGATGCTGG + Intronic
917768840 1:178253710-178253732 TTTCTGAGCCAGGATGAGCCAGG + Intronic
917844176 1:179006585-179006607 CCTCAGAAGCAGGACCAGGCCGG + Intergenic
918827104 1:189338143-189338165 TTTTAGTATCAGGATGATGCTGG - Intergenic
919141152 1:193573321-193573343 TTTCGGAATCAGGATGACGCTGG + Intergenic
919215139 1:194543528-194543550 TTTTGGAATCAGGATGATGCTGG + Intergenic
919271758 1:195357694-195357716 TTTCAGTATCAGGATGATGCTGG - Intergenic
920355698 1:205370622-205370644 ATTCAGAAGTCAGATGAGGCCGG - Intergenic
921591943 1:217014218-217014240 TTTCTGAAGCTGGATGAAGTGGG + Intronic
922153607 1:223024623-223024645 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
923186968 1:231583517-231583539 TCGCTGAGGCAGGATGAGGCTGG - Intronic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923654795 1:235906224-235906246 CTTCAGAAGCTGGAAAAGGCAGG + Intergenic
923800666 1:237205567-237205589 GGTCAGAGGCAGGATGGGGCTGG + Intronic
924100091 1:240594253-240594275 TCTCAAAACCAGGATGAGGCCGG - Intronic
924831003 1:247594887-247594909 TTTTAGTACCAGGATGATGCTGG + Intergenic
924871806 1:248055429-248055451 TTTTGGAAGCAGGATGATGCTGG + Intronic
1062790543 10:301665-301687 TTTCAGGAGATGGAAGAGGCAGG - Intronic
1064629700 10:17297185-17297207 TTTTAAAGGCAGGATGGGGCTGG - Intergenic
1064908295 10:20371070-20371092 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1065059650 10:21886484-21886506 TTTTAGTATCAGGATGATGCTGG - Intronic
1065120277 10:22523038-22523060 TTTTGGAATCAGGATGATGCTGG + Intergenic
1065442696 10:25769182-25769204 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1066123348 10:32313592-32313614 TTTAAGAAGAAGGAACAGGCTGG + Intronic
1066699213 10:38108988-38109010 TTTCGGTATCAGGATGATGCTGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067706600 10:48610926-48610948 TTTCAGAAGCAGGCTCAGAGCGG + Intronic
1068231435 10:54172259-54172281 TTTCTGAGCCAGGATGAGCCAGG - Intronic
1068732457 10:60374398-60374420 TTTCAGGAAGAGGGTGAGGCAGG + Intronic
1068743378 10:60500691-60500713 GTTCAGATTAAGGATGAGGCAGG - Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069120454 10:64563633-64563655 TTTTGGAATCAGGATGATGCCGG + Intergenic
1069296963 10:66858386-66858408 TTTTGGTACCAGGATGAGGCTGG + Intronic
1070213529 10:74351083-74351105 TTTTGGAATCAGGATGATGCTGG - Intronic
1070402937 10:76069237-76069259 TTTCACAAGCATGATGGGGAAGG + Intronic
1070407205 10:76107489-76107511 TTCCAGAAACAGGGTGAGACAGG - Intronic
1071785215 10:88892084-88892106 TTTGAGATGCAGGGTGAGGGAGG + Intronic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1072509743 10:96108189-96108211 TTTTAGTATCAGGATGATGCTGG + Intergenic
1072774997 10:98182384-98182406 TTCCAGAGGAAGGATCAGGCAGG - Intronic
1072854453 10:98932455-98932477 TTTTGGAATCAGGATGATGCTGG + Intronic
1073011751 10:100365489-100365511 TTTCAGAAACAGGAAAAAGCTGG - Intergenic
1073526513 10:104188307-104188329 TTCCAGAAGCAGGGAGAAGCAGG - Exonic
1073933945 10:108607870-108607892 TTTTTGAATCAGGATGATGCTGG + Intergenic
1074030587 10:109684050-109684072 CTTCAGTATCAGGATGATGCTGG + Intergenic
1074642221 10:115399189-115399211 TTTTAGTATCAAGATGAGGCTGG + Intronic
1074774071 10:116753534-116753556 TATGACAGGCAGGATGAGGCAGG - Intergenic
1075117826 10:119641840-119641862 CTCCAGAAGCTGGAAGAGGCAGG - Intergenic
1075164970 10:120059676-120059698 TTTAAGAAGCCAGATTAGGCCGG + Intergenic
1075213147 10:120508766-120508788 TTTGAGTAGCAGGAGGAGGTTGG - Intronic
1076404925 10:130205267-130205289 ATTCAGAAGCTTGGTGAGGCAGG - Intergenic
1076791277 10:132778017-132778039 TTTCAAACTCAGGATGACGCTGG - Intronic
1076966039 11:85883-85905 TTTCAGAATCAGGGTAATGCTGG - Intergenic
1078406988 11:11079072-11079094 TTTATGAGGTAGGATGAGGCTGG + Intergenic
1078470219 11:11580465-11580487 GTTCAGTAGCAGGATGCGGAAGG - Intronic
1079265223 11:18924858-18924880 TTTTGGTATCAGGATGAGGCTGG - Intergenic
1079278507 11:19065258-19065280 TTTTGGTATCAGGATGAGGCTGG + Intergenic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079349813 11:19682967-19682989 TTGCAGAACTAGGATGAGGGAGG + Intronic
1079587724 11:22146840-22146862 TTTTGGTAGCAGGATGATGCTGG + Intergenic
1081079878 11:38728610-38728632 TTTAGGTAGCAGGATGATGCTGG + Intergenic
1081094619 11:38917834-38917856 TTTGAGTATCAGGATGATGCTGG + Intergenic
1081316361 11:41635930-41635952 TTTTAGTATCAGGATGATGCTGG + Intergenic
1081543956 11:44056534-44056556 TTTAAAATACAGGATGAGGCCGG + Intronic
1082575750 11:54801262-54801284 CTTCAGTATCAGGATGATGCTGG - Intergenic
1082673697 11:56069090-56069112 TTACAGAAGGAGGATGATGAAGG + Intergenic
1082994265 11:59237225-59237247 TTTTAGTATCAGGATGATGCTGG - Intergenic
1083533995 11:63452271-63452293 TTTTGGAATCAGGATGATGCTGG + Intergenic
1084276748 11:68055746-68055768 TTTATAAAGCAGGCTGAGGCCGG + Intronic
1084773061 11:71356894-71356916 TTTCTGGAGCTGGAAGAGGCAGG + Intergenic
1085752214 11:79171372-79171394 TTTCAGAGCCAGGATGAGTGAGG + Intronic
1086030178 11:82345272-82345294 CTTCAGTATCAGGATGATGCTGG - Intergenic
1086247650 11:84773427-84773449 TTTTGGTAGCAGGATGATGCTGG - Intronic
1086789519 11:91018156-91018178 TTTCTGTATCAGGATGATGCTGG + Intergenic
1086979438 11:93177711-93177733 TTCCAGAGGAAGGATCAGGCAGG - Intronic
1087278171 11:96180995-96181017 TTTCTGAGCCAGGATGAGCCAGG + Intronic
1087773350 11:102235179-102235201 TTACAGAAGCAGGGAGAGTCTGG - Intergenic
1088294127 11:108273858-108273880 TTTTGGAATCAGGATGATGCTGG + Intronic
1088591716 11:111409055-111409077 TTTCAGAAGGAGGAAGAGATGGG + Intronic
1088806216 11:113354943-113354965 TTTGGGAATCAGGATGATGCTGG + Intronic
1089150645 11:116361192-116361214 TTTTAGCTGCAGTATGAGGCTGG - Intergenic
1089377329 11:118003860-118003882 TTCCACATGAAGGATGAGGCAGG + Intergenic
1089473709 11:118741507-118741529 TCTCAAAAGCAGAATGAAGCTGG + Intergenic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1089863412 11:121610772-121610794 TTTAAGAACCAGGCTGAAGCTGG + Intronic
1090321537 11:125848543-125848565 TTTCAGTATCAGGATGGTGCTGG - Intergenic
1090404066 11:126466809-126466831 TTTCTGAAGCAGGAGGTGGGAGG - Intronic
1090573946 11:128079867-128079889 TTTTAGTATCAGGATGATGCTGG - Intergenic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091395232 12:150295-150317 TTTCAGAGGCAGGGAGATGCTGG + Intronic
1091598663 12:1901855-1901877 TTTCAGTATCAGGATAATGCTGG - Intronic
1092316694 12:7423985-7424007 TTTTGGAATCAGGATAAGGCTGG - Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1092691216 12:11112308-11112330 TTTTGGAATCAGGATGATGCTGG - Intronic
1093060385 12:14596207-14596229 TTTTGGCATCAGGATGAGGCTGG + Intergenic
1093324243 12:17754483-17754505 TTTTGGAATCAGGATGATGCTGG + Intergenic
1093358233 12:18195912-18195934 TTTTTGAGCCAGGATGAGGCAGG - Intronic
1093396918 12:18693877-18693899 TCACACAAGCAGGATGACGCTGG + Intronic
1093510258 12:19918381-19918403 TTTTAGTATCAGGATGATGCTGG - Intergenic
1093677039 12:21954853-21954875 TTTCAGAAAATGGATGAGGAGGG - Intergenic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094114988 12:26901462-26901484 TTTTGGAATCAGGATGATGCTGG - Intergenic
1094220324 12:27985960-27985982 ATTCAGAGGAAGGATGAGCCTGG + Intergenic
1094241883 12:28237585-28237607 TATCAGAAGCTGGAACAGGCAGG + Intronic
1094317884 12:29151947-29151969 TTTCAGAAGTAGCTTGAGGAAGG + Intronic
1094432724 12:30387963-30387985 TTTAAGAGTCAGGGTGAGGCCGG + Intergenic
1094677001 12:32630431-32630453 TTTCGGAGGGAGGTTGAGGCAGG + Intronic
1095472152 12:42548822-42548844 TTTAAGAAGAAGGGTGAGGCCGG + Intronic
1095674606 12:44901554-44901576 TTTTGGTACCAGGATGAGGCTGG - Intronic
1095831157 12:46588162-46588184 TTTTGGAATCAGGATGATGCTGG + Intergenic
1096310334 12:50515121-50515143 TTTCAGAAGCTTAATGAGGCAGG - Intronic
1096940279 12:55336585-55336607 TTTTAGTATCAGGATGATGCTGG + Intergenic
1097737651 12:63199864-63199886 TTTTAGTATCAGGATGATGCTGG - Intergenic
1097920483 12:65067502-65067524 TTTCTGAAGCGGGATGAGTTGGG + Intronic
1098175417 12:67785286-67785308 TTACAGAAGTAGGATGAGAATGG + Intergenic
1098187648 12:67914892-67914914 TTACAGCAGAAGGATGAGGAAGG + Intergenic
1098839661 12:75463606-75463628 TTTTGGAATCAGGATGATGCTGG + Intergenic
1099022786 12:77426830-77426852 TTTTGGAAACAGGATAAGGCTGG + Intergenic
1099431237 12:82588831-82588853 TTTTAGTATCAGGATGATGCTGG - Intergenic
1099634918 12:85201277-85201299 TTTTAGTATCAGGATGATGCTGG + Intronic
1099707262 12:86171773-86171795 TTTCAGAAGTATGATGTGACTGG - Intronic
1100744125 12:97626893-97626915 TTTCAGAAACTGGAGGAGGTCGG + Intergenic
1100890254 12:99117683-99117705 TTTTGGTATCAGGATGAGGCTGG + Intronic
1100921428 12:99492554-99492576 TTTTAGTATCAGGATGATGCTGG - Intronic
1101445148 12:104732136-104732158 GCTCAGAAGCAGGAGGTGGCAGG + Intronic
1102167991 12:110821209-110821231 TTTGAGAAGAAAGAAGAGGCTGG - Intergenic
1102762522 12:115400788-115400810 TGTTAAAAGCTGGATGAGGCTGG + Intergenic
1102771113 12:115477495-115477517 TTACAGCAGCACTATGAGGCAGG - Intergenic
1104161220 12:126182617-126182639 TTTTAAAAGCAGAATAAGGCTGG - Intergenic
1104378215 12:128283931-128283953 GTTCAGAAGCAGGAGGAAGAGGG + Intronic
1104539784 12:129653185-129653207 TTTGATAACCAGGATGAGGAGGG + Intronic
1105202132 13:18190060-18190082 TCTCAGAAGCAGGAGGTTGCTGG + Intergenic
1105552277 13:21409094-21409116 TTTCGGTATCAGGATGATGCTGG + Intronic
1106334657 13:28772782-28772804 TTTTGGAATCAGGATGATGCTGG + Intergenic
1106396405 13:29385130-29385152 TCTCAGAAGCATCATAAGGCTGG + Intronic
1106611965 13:31292296-31292318 TTTTAGTATCAGAATGAGGCTGG + Intronic
1106940926 13:34778421-34778443 TTTCTGAAACAGGTTGAGGCAGG + Intergenic
1107723683 13:43276299-43276321 TTACAGAGGCAGGATGGGGCGGG - Intronic
1108262406 13:48671764-48671786 TTTTAGCATCAGGATGATGCTGG + Intronic
1108513365 13:51174758-51174780 TTTCTGAGCCAGGATGAGCCAGG - Intergenic
1108673689 13:52717828-52717850 TTTTAGTATCAGGATGATGCTGG + Intronic
1108912963 13:55578452-55578474 TTTTTGAACCAGGATGAGCCAGG + Intergenic
1108952279 13:56110184-56110206 TTTCTGAGCCAGGATGAGCCAGG - Intergenic
1108952489 13:56112636-56112658 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1109531529 13:63654920-63654942 TTTTAGTATCAGGATGATGCTGG + Intergenic
1109717151 13:66232116-66232138 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1109979907 13:69894271-69894293 TTGCACAAGCAGGATTACGCTGG - Intronic
1109988476 13:70021189-70021211 TTTCAGAAGATGGGGGAGGCAGG - Intronic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110659415 13:78041864-78041886 TTTAAGAATCAGCAGGAGGCTGG - Intergenic
1110662624 13:78075225-78075247 TTTTGGAATCAGGATGATGCTGG + Intergenic
1110866653 13:80403933-80403955 TTTCAGTACTAGGATGATGCTGG + Intergenic
1110937771 13:81314497-81314519 TTTCAGTATCATAATGAGGCTGG - Intergenic
1111386609 13:87536685-87536707 TCTCAGAAGCGGGATGTGGTAGG + Intergenic
1111424029 13:88056086-88056108 CTCCAGAAGCTGGAAGAGGCAGG - Intergenic
1111434964 13:88194391-88194413 CTTCAGTATCAGGATGATGCTGG + Intergenic
1111526121 13:89473209-89473231 TTTTAGTATCAGGATGATGCTGG + Intergenic
1111632034 13:90854057-90854079 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1113472535 13:110557166-110557188 TATCAGAAGCTGGAGGAGGGAGG + Intronic
1113675029 13:112201473-112201495 TTTCAGAGGGAGGATGAAACGGG - Intergenic
1113859052 13:113469209-113469231 TTTCAGAAGGAGGATGGTTCGGG - Intronic
1114149942 14:20026894-20026916 TTTCAGAGGCTGGAGGAGGCAGG - Intergenic
1114453944 14:22843663-22843685 TTTCAGACTTAGGAGGAGGCGGG - Intronic
1114964429 14:27939723-27939745 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
1115649114 14:35390532-35390554 TTACAGAGGCAGGATGGGGAGGG + Intergenic
1115924539 14:38416134-38416156 TTTTGGTAGCAGGATGATGCTGG - Intergenic
1116073578 14:40081841-40081863 TTTTAGTATCAGGATGATGCTGG - Intergenic
1116690523 14:48100422-48100444 TTTTAGTATCAGGATGATGCTGG - Intergenic
1116771118 14:49128343-49128365 TTTTGGAATCAGGATGATGCTGG + Intergenic
1117234508 14:53757202-53757224 TTTTAGTACCAGGATGACGCTGG - Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117777996 14:59201621-59201643 TTTTAGAAGGGGGGTGAGGCAGG - Intronic
1118545049 14:66876900-66876922 TTTCGGTATCAGGATGATGCTGG - Intronic
1118764622 14:68901541-68901563 TTTAAAATGCATGATGAGGCCGG - Intronic
1119282965 14:73426346-73426368 GTTCAGAAGCAGGCAGTGGCTGG + Intronic
1119513426 14:75229471-75229493 GTTCAGAGGGAGGATCAGGCAGG + Intergenic
1120344319 14:83265843-83265865 TTTAAAAAGCAGATTGAGGCTGG + Intergenic
1120427975 14:84374992-84375014 TTTCAGAAGAATGATGGGCCTGG + Intergenic
1120624839 14:86812269-86812291 TTTTGGAATCAGGATGATGCTGG + Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1120978447 14:90270265-90270287 TCACACAAGCAGGATGACGCTGG + Exonic
1122575281 14:102738042-102738064 TTTCAGAAACAAGAGCAGGCAGG - Intergenic
1122823449 14:104358599-104358621 TTTCAGGAGCATGAGGAGGTGGG + Intergenic
1124559237 15:30756666-30756688 TTTTACAGGCAGGAAGAGGCTGG + Intronic
1124672017 15:31649055-31649077 TTTTACAGGCAGGAAGAGGCTGG - Intronic
1125409499 15:39390706-39390728 TTTCAGTAGAAGGATGAGGCAGG - Intergenic
1125838551 15:42775882-42775904 CTTCCAAAGCAGGATGTGGCAGG - Intronic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126144809 15:45464466-45464488 TTTAAGGAGCAGGAGGAGGTTGG + Intergenic
1126554415 15:49969777-49969799 TTTTGGTATCAGGATGAGGCTGG - Intronic
1127033765 15:54891928-54891950 TTTCAGTATCAGGGTGATGCTGG + Intergenic
1127189800 15:56517304-56517326 TTTCATTATCAGGATGATGCTGG - Intergenic
1127374060 15:58366559-58366581 TTTTGGTATCAGGATGAGGCTGG - Intronic
1127616668 15:60692955-60692977 TTTCGGTATCAGGATGATGCTGG - Intronic
1128295608 15:66516337-66516359 TTTTGGAGGCAGGAGGAGGCTGG - Intronic
1128761338 15:70218000-70218022 TTTCTGATGCATGCTGAGGCAGG + Intergenic
1128857161 15:71028431-71028453 TTTCAGTATCAGGATGATGCTGG + Intronic
1128981210 15:72187758-72187780 TTTCAGAGGCTGGCTGAGGCTGG - Intronic
1130050267 15:80478572-80478594 TGTCAGGAACAAGATGAGGCTGG + Intronic
1130179736 15:81612934-81612956 TGTCAGCAGGAGGAGGAGGCGGG - Intergenic
1131140938 15:89976699-89976721 TATAAGAAGCAAGATGAGGCTGG + Intergenic
1131445158 15:92492757-92492779 TTCCATCTGCAGGATGAGGCTGG + Intronic
1132442093 15:101877641-101877663 TTTCAGAATCAGGGTAATGCTGG + Intergenic
1132600759 16:771777-771799 TGCCAGAAGCTGGAGGAGGCAGG + Intronic
1133078586 16:3299699-3299721 ATTCAGAGGAAGGATGAGCCGGG + Exonic
1133455851 16:5941872-5941894 TTTCTGAAGCAGACTCAGGCCGG - Intergenic
1134125303 16:11612326-11612348 TTTCACAAGAATGATGAGGACGG - Intronic
1134466886 16:14486813-14486835 TGTCAGAAGCAGCATGTAGCAGG + Intronic
1134640956 16:15828885-15828907 TTTAAAAAGAAGGAAGAGGCCGG + Intronic
1135300138 16:21319674-21319696 TTTCAGCAGCAGCACCAGGCTGG - Intergenic
1135391323 16:22095805-22095827 TTTGGGAGGCAGGCTGAGGCAGG - Intronic
1135668544 16:24355798-24355820 CTTCAAAAGCTGGATGGGGCTGG - Intronic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1138650598 16:58458828-58458850 TTCCAGAGCCAGGCTGAGGCCGG + Intergenic
1138812861 16:60171294-60171316 TTTAAAAACCATGATGAGGCCGG + Intergenic
1138815732 16:60200882-60200904 CTTTAGAGGCAGGATGAGCCAGG - Intergenic
1138976178 16:62210944-62210966 TTTTAGTATCAGGATGATGCTGG + Intergenic
1139098830 16:63740351-63740373 TTTCAGTATCAGGATAATGCTGG - Intergenic
1139531338 16:67544133-67544155 TTCCAGAAGGAGGAAGGGGCTGG - Intronic
1139940953 16:70605002-70605024 TCTCAGAACCAGGATTAGGCTGG + Intronic
1140165581 16:72547186-72547208 TTTTAGAACCAGGATGATGCTGG - Intergenic
1140172559 16:72622013-72622035 TTGCAGAAACAGGATATGGCTGG + Intergenic
1140954912 16:79854027-79854049 TTTTGGTATCAGGATGAGGCTGG + Intergenic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141338062 16:83176144-83176166 TTTAAAAAGTAGGTTGAGGCCGG - Intronic
1141716455 16:85729806-85729828 TATCAGAAGCTGGAAGAGGCAGG + Intronic
1141844623 16:86598974-86598996 TCTCAAAAGCAGGTGGAGGCAGG - Intergenic
1141855054 16:86675110-86675132 GTTAAGAATCAAGATGAGGCTGG - Intergenic
1142782156 17:2189765-2189787 TTTCAGAAGTGGGTTGGGGCTGG - Intronic
1142916101 17:3139816-3139838 TTTTAGTATCAGGATGATGCTGG + Intergenic
1144146633 17:12405227-12405249 TTTAAGAAGCAAGTTGAGGCTGG - Intergenic
1144372102 17:14601436-14601458 TTTTGGTATCAGGATGAGGCTGG - Intergenic
1144810755 17:17997407-17997429 TTTCAGGAGCAGGCTGCGGAGGG - Intronic
1145843185 17:28013677-28013699 TATCACAAGAAGGATGAGTCAGG + Intergenic
1146466304 17:33089370-33089392 TTCTAGAAGCAGGAAAAGGCAGG + Intronic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1146682795 17:34820668-34820690 TTTCAGGAGCAGGAGGAAGATGG - Intergenic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1147904598 17:43814481-43814503 TTCCAGTAGCAGGAGGAGGTTGG - Intronic
1147996256 17:44362025-44362047 TTTCAGAAGAGGGAGGGGGCTGG + Intronic
1148073617 17:44922704-44922726 TGGAAGAGGCAGGATGAGGCAGG + Intergenic
1148226464 17:45901189-45901211 TTTCAGGAAGAAGATGAGGCAGG - Intronic
1148713726 17:49700518-49700540 CTTCAGCAGCTGGAGGAGGCAGG + Intergenic
1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG + Intergenic
1149241836 17:54660015-54660037 TTTTGGAATCAGGATGATGCTGG + Intergenic
1149333107 17:55606805-55606827 TTTAAGAAGCAGGAGGAAGGAGG - Intergenic
1149395475 17:56237245-56237267 TTTTAGTATCAGGATGATGCTGG + Intronic
1149802702 17:59585424-59585446 TTTAAGAAGCATTTTGAGGCTGG + Intronic
1149843789 17:59990067-59990089 TTTAAGAAGCATTTTGAGGCTGG - Intergenic
1150454385 17:65294999-65295021 TTAAAGAAGCAAGAGGAGGCTGG + Intergenic
1150842413 17:68621152-68621174 TTTCACAAACAGCATGAGGTTGG - Intergenic
1151333448 17:73424922-73424944 TTTCAAAAGCAGAACCAGGCTGG + Intronic
1152047384 17:77946382-77946404 TTTCAAGAGCAGGATTAGGAGGG - Intergenic
1152902755 17:82953658-82953680 TTTTGGAATCAGGATGATGCTGG - Intronic
1152983570 18:302083-302105 TCTCAGGAGGAGGTTGAGGCAGG - Intergenic
1153119415 18:1703298-1703320 TTTTAGAATCAGGATGATGCTGG - Intergenic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1153974428 18:10255146-10255168 TTTCAGTATCAGGATGATGCTGG + Intergenic
1155574767 18:27232457-27232479 TTTTAGAGCCAGGATGAGCCAGG - Intergenic
1156654142 18:39263454-39263476 TTTTAGTATCAGGATGATGCTGG - Intergenic
1157518235 18:48326390-48326412 TTTTAGAAGAAGGTAGAGGCCGG - Intronic
1158114152 18:53976245-53976267 CTTCAGTATCAGGATGATGCTGG + Intergenic
1158207002 18:55004481-55004503 TCTCAAAGGCAGGAAGAGGCTGG + Intergenic
1158659000 18:59368462-59368484 TTTTGGTACCAGGATGAGGCTGG + Intergenic
1159693961 18:71529746-71529768 TTTTGGTATCAGGATGAGGCTGG - Intergenic
1160642843 19:155513-155535 TTTCAGAATCAGGGTAATGCTGG - Intergenic
1160964031 19:1737921-1737943 CTACAGAATGAGGATGAGGCCGG + Intergenic
1161133537 19:2606085-2606107 TTTAAGAGTCAGGAAGAGGCTGG + Intronic
1161266434 19:3366727-3366749 GTTTTGAAGCAGGAGGAGGCGGG + Intronic
1161628905 19:5341455-5341477 TGTAAGAAGCTGGCTGAGGCGGG - Intergenic
1162211875 19:9098421-9098443 GTACAGAAGGAAGATGAGGCCGG - Intergenic
1162796423 19:13089791-13089813 TTCCCGAAGCAGGGTGGGGCCGG + Intronic
1163620896 19:18359397-18359419 TTTGAGGAGCAGGAGGAAGCTGG - Intronic
1163918221 19:20261606-20261628 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1164046754 19:21549888-21549910 TTTTGGAATCAGGATGATGCTGG + Intronic
1164248550 19:23457078-23457100 TTCCAGAGGAAGGATCAGGCAGG - Intergenic
1164452092 19:28375213-28375235 TGTCAGGAGCTGGGTGAGGCCGG - Intergenic
1164713684 19:30376558-30376580 TTTCAGAAACAGAATGGGCCAGG + Intronic
1165270927 19:34706951-34706973 TTTTGGAATCAGGATGATGCTGG - Intergenic
1165709470 19:37999764-37999786 TTTAGGAAACAGGATGAGTCTGG + Intronic
1165822519 19:38685585-38685607 TTTCAGAAGCAGAGTGAGTTTGG - Intronic
1167673460 19:50870088-50870110 GTTCCGAAGGAGGAAGAGGCTGG + Intronic
1167736007 19:51294909-51294931 TCTCTGAAGAAGGCTGAGGCTGG - Intergenic
1168646173 19:58060353-58060375 TTTCAGAGGCAGGCTGTGGTTGG - Intronic
925591119 2:5511023-5511045 TTTCAGAAGCAGTGTCAGCCTGG - Intergenic
925647275 2:6048837-6048859 TTTTAGTACCAGGATGATGCTGG - Intergenic
925791691 2:7495217-7495239 TTTGGGAAGGAGGCTGAGGCGGG - Intergenic
926410565 2:12597897-12597919 TTCCAGAAGAAAGAAGAGGCAGG - Intergenic
926420503 2:12692101-12692123 TACCAGAAACAGGAAGAGGCAGG - Intergenic
926863670 2:17336033-17336055 TTTTTGAACCAGGATGAGCCAGG - Intergenic
926929188 2:18019547-18019569 TTTCAGTATCAGAATGATGCTGG + Intronic
927390797 2:22592933-22592955 TTTTAGTACCAGGATGATGCTGG - Intergenic
927884867 2:26712201-26712223 TCTCAGAAACAGGCTGAGGTGGG + Intronic
927912870 2:26914088-26914110 TTTCAGCAGCAGCATCAGACCGG + Intronic
928478760 2:31658871-31658893 TTTCAGTAGCAGAATGATGCTGG - Intergenic
928788254 2:34917070-34917092 TTTCAGTGGCAGAATGATGCTGG - Intergenic
928880498 2:36092041-36092063 TCTCAGAATCAGGATGATGCTGG - Intergenic
929205817 2:39291587-39291609 TTTTAGAAACAGAAAGAGGCTGG + Intronic
929245079 2:39693000-39693022 ATTCATCAGGAGGATGAGGCAGG + Intronic
929262196 2:39878177-39878199 TTTTGGAATCAGGATGATGCTGG + Intergenic
929280137 2:40069136-40069158 TTTTAGTATCAGGATGATGCTGG + Intergenic
929610783 2:43269278-43269300 TTTCAGAAGCAGCAAGAGTCAGG + Intronic
930175678 2:48299175-48299197 TTTCAGTATCAGGATGATGCTGG + Intergenic
930679418 2:54240615-54240637 TGTCACAAGTATGATGAGGCAGG - Intronic
930704486 2:54490734-54490756 TTAGTGAAGAAGGATGAGGCTGG + Intronic
931540252 2:63323254-63323276 TTTTAGAAGCAGGACTAGCCTGG - Intronic
931850063 2:66244089-66244111 CTTCTGAACCAGGATGAGCCAGG - Intergenic
931889725 2:66658287-66658309 TTTCAGCATCAGGATGATGCTGG + Intergenic
933166308 2:79080234-79080256 TTTTGGTATCAGGATGAGGCTGG + Intergenic
933237379 2:79880303-79880325 TTTCAGTATCAAGATGATGCGGG + Intronic
933766231 2:85711446-85711468 TTCCAGAAGGAGGATGACGGGGG + Intergenic
933873379 2:86592961-86592983 TTTGGGAGGCAGGATGAGTCAGG - Intronic
934040668 2:88125457-88125479 TTTCAGAGGGAGGAGGAGACGGG + Intronic
934703067 2:96458362-96458384 TTTTGGAATCAGGATGATGCTGG - Intergenic
935265647 2:101391639-101391661 TATAAGAAGCAGCATCAGGCTGG + Intergenic
935786051 2:106549907-106549929 CTCCAGAAGCTGGAAGAGGCAGG - Intergenic
936081327 2:109434562-109434584 ACTCAGAAGCAGGAAGAGGGTGG - Intronic
936111050 2:109665203-109665225 TTTGAGATGCAGAATGATGCTGG + Intergenic
936495262 2:113014939-113014961 TTTCAGAAGCAGGCTGTGTGGGG + Intergenic
936562888 2:113557163-113557185 TGCCAGAAGCTGGAAGAGGCAGG - Intergenic
936769209 2:115891580-115891602 TTTTAGTAGCAGGATGATGCTGG + Intergenic
936810978 2:116401601-116401623 TTTTGGAATCAGGATGATGCTGG - Intergenic
936900459 2:117476200-117476222 TTTTGGAATCAGGATGATGCTGG - Intergenic
937256749 2:120561141-120561163 TTTCTGAGGAGGGATGAGGCGGG + Intergenic
937610845 2:123859070-123859092 TTTTAGTATCAGGATGATGCTGG - Intergenic
937673254 2:124561229-124561251 TTTCAGAAGCAGGGAGATGCTGG + Intronic
937715833 2:125031169-125031191 TTTCAGAAAAAGGATGAGCAAGG - Intergenic
937994244 2:127680950-127680972 TCTCAGAGGCAGGGAGAGGCAGG - Intronic
938034844 2:128027530-128027552 TTTCAGACCCTGGCTGAGGCGGG - Intronic
938632752 2:133186441-133186463 TTTTAGTATCAGGATGATGCTGG + Intronic
938701741 2:133885716-133885738 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
938732780 2:134159540-134159562 CTTCATAAGTAGTATGAGGCTGG + Intronic
938873972 2:135513529-135513551 TTTCATATGCAGCATGAGGTGGG - Intronic
939180721 2:138799584-138799606 TTTTGGTATCAGGATGAGGCTGG - Intergenic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
939730900 2:145783160-145783182 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
939954627 2:148517282-148517304 GTTAAGAAGCAGTAAGAGGCTGG - Intronic
940591162 2:155729549-155729571 ATTCAGAGGAAGGCTGAGGCTGG - Intergenic
941686179 2:168451359-168451381 TTTGGGAAGGAGGCTGAGGCAGG + Intergenic
942010781 2:171760858-171760880 TTCCAGAAGAAGGAACAGGCAGG - Intergenic
942038235 2:172032189-172032211 TTTCGGGAGTGGGATGAGGCTGG - Intronic
942124690 2:172811629-172811651 TTTCAGCAGCAGGCGAAGGCAGG + Intronic
942873378 2:180763307-180763329 TTTTAGAGGCAAAATGAGGCTGG + Intergenic
943455907 2:188106503-188106525 TTTTGGAATCAGGATGATGCTGG - Intergenic
943629959 2:190239985-190240007 TTTTGGTATCAGGATGAGGCTGG + Intronic
944364054 2:198895578-198895600 TTTCAGTATGAGGATGATGCTGG - Intergenic
945016565 2:205524753-205524775 TTTCATTAGAAGGGTGAGGCTGG - Intronic
945207575 2:207348106-207348128 TTTCAGTATCAGGATGATGCTGG - Intergenic
945362484 2:208908121-208908143 TTTTTGAGCCAGGATGAGGCAGG - Intergenic
945673366 2:212828928-212828950 TTTAAGATGTAGTATGAGGCTGG + Intergenic
945678633 2:212886110-212886132 TTTTGGAATCAGGATGATGCTGG - Intergenic
945945556 2:215992051-215992073 TTTTGGTATCAGGATGAGGCTGG - Intronic
946103423 2:217347993-217348015 TTTTGGTATCAGGATGAGGCTGG + Intronic
946164425 2:217855303-217855325 TTTCACGGGCAGGATGAGGAAGG - Intronic
946653051 2:221914879-221914901 TTTCAGAAACAGCATGGGGGAGG - Intergenic
947068625 2:226260249-226260271 TTTTGCTAGCAGGATGAGGCCGG - Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947281187 2:228457039-228457061 TTTTGGTAGCAGGATGATGCTGG + Intergenic
947804526 2:232956469-232956491 TTTAAGAACCAGAATTAGGCTGG + Intronic
947867416 2:233408847-233408869 TTAAAGAAGCAGGAGGAAGCAGG + Intronic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1169484894 20:6020926-6020948 CTTAAAAAGCAGGATTAGGCCGG - Intronic
1170164210 20:13345079-13345101 TTTAAGAGGCAGAATCAGGCAGG - Intergenic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1171281762 20:23906294-23906316 TTTCAGTATCAAGATGATGCTGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171936678 20:31280803-31280825 TTTTAGTATCAGGATGATGCTGG - Intergenic
1171969320 20:31553841-31553863 GTTCTGAAGCAGGGTGAGCCCGG - Intronic
1173069424 20:39747384-39747406 GTTTACAAGCAGTATGAGGCTGG - Intergenic
1173750812 20:45474661-45474683 TTTTAGTATCAGGATGATGCTGG + Intronic
1174051720 20:47771691-47771713 TGTCAGTGGCAGGATGGGGCGGG + Intronic
1175010410 20:55728883-55728905 TCTAAGTAACAGGATGAGGCAGG + Intergenic
1175071456 20:56337243-56337265 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
1175709113 20:61205172-61205194 TTTCATCAGGAGGATGAGGGGGG + Intergenic
1176013836 20:62917506-62917528 TTTCAGACTCAGCATGTGGCAGG - Intronic
1176072038 20:63232274-63232296 TTTAAGTCGCAGGATGAGACAGG - Intergenic
1176221064 20:63969630-63969652 TTTCTGGAGAAGGAGGAGGCAGG + Intronic
1176715819 21:10347948-10347970 TCTCAGAAGCAGGAGGCTGCTGG - Intergenic
1177313543 21:19427815-19427837 TTTCCGTATCAGGATGATGCTGG - Intergenic
1177418227 21:20822384-20822406 TTTCATAAGCAGGAAGTGACAGG + Intergenic
1177764102 21:25437128-25437150 TTTTTGAATCAGGATGATGCTGG - Intergenic
1178065679 21:28902169-28902191 CTTCAGGAGGAGGCTGAGGCAGG - Intergenic
1178356122 21:31911893-31911915 TTTCTGCAGCAGGAAAAGGCTGG + Intronic
1178506482 21:33167100-33167122 CTCCAGAAGCTGGAAGAGGCTGG + Intronic
1178762874 21:35421008-35421030 TTTCTGCAGAAGGATGAGGCAGG - Intronic
1179257589 21:39730133-39730155 TAGCAGAAGCAGGAAGAAGCAGG - Intergenic
1179366426 21:40762617-40762639 TTTTGGAATCAGGATGATGCTGG - Intronic
1179566487 21:42252229-42252251 TTCCAGAAGCAGGAGTTGGCTGG - Intronic
1179649864 21:42801064-42801086 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1181935750 22:26437173-26437195 GGTCAGAAGCAGGATAAGCCTGG + Intronic
1182587976 22:31356863-31356885 TTTAAGAAGCAGGAGAGGGCAGG - Intergenic
1183068105 22:35377592-35377614 TTGAAGATGGAGGATGAGGCTGG - Intergenic
1184189118 22:42883193-42883215 TGGCAGGAGCAGGGTGAGGCTGG - Intronic
1184259095 22:43304480-43304502 TGTGAGAAGCAGGAACAGGCAGG + Intronic
1184298091 22:43538801-43538823 TTACAGCAGCAGTAGGAGGCTGG - Intronic
1184376689 22:44117910-44117932 TGTCAGAAGCAGGATTGGCCAGG + Intronic
1184889145 22:47368878-47368900 TTTCAGCTGCAGGAGCAGGCCGG - Intergenic
1185387100 22:50538769-50538791 TTACAGAAACAGGAGGTGGCTGG - Intergenic
949200680 3:1375323-1375345 TTTCAGTAGCAGAATGAGACTGG + Intronic
949955394 3:9263875-9263897 TTTTAGTATCAGGATGATGCTGG - Intronic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950356566 3:12415222-12415244 TCTCAGAAGCAGGATGTGTGTGG - Intronic
951012228 3:17693877-17693899 TTCCAGAGGAAGGATCAGGCAGG + Intronic
951346885 3:21557647-21557669 TTTTAGTATCAGGATGATGCTGG + Intronic
952382584 3:32816830-32816852 TTTCAGAAAGAAGATGACGCGGG + Intergenic
952872395 3:37912348-37912370 TTTCAAAAGCAGCAAGAGGCTGG - Intronic
953046146 3:39295549-39295571 TGTCAGAAGCAGGTTCTGGCTGG + Intergenic
953543904 3:43847194-43847216 TTTTAGTATCAGGATGATGCTGG - Intergenic
953600771 3:44361954-44361976 TTTTAGAAGCAGCATAAGGTTGG - Intronic
953972031 3:47355462-47355484 TTACAGATACAGGATGCGGCAGG + Intergenic
954528917 3:51300889-51300911 TTTTAGTATCAGGATGATGCTGG + Intronic
955273073 3:57520950-57520972 TTTCTGCAGGAGGCTGAGGCAGG + Intronic
956378082 3:68636805-68636827 TCACACAAGCAGGATGACGCTGG + Intergenic
956443865 3:69307046-69307068 TTTCAGAAGAAGTATGAGCGGGG - Intronic
957811296 3:85226103-85226125 TTTTAGTATCAGGATGATGCTGG + Intronic
958260928 3:91380235-91380257 TTTCGGAATCAGGATGATGCTGG + Intergenic
958542969 3:95503255-95503277 TTTCAAAAGCAGTATTAGGGAGG - Intergenic
959117494 3:102195362-102195384 TTTCTGAAGCAGCCTGAAGCAGG - Intronic
959506778 3:107164857-107164879 GTTCAGAACTAGGCTGAGGCTGG + Intergenic
959617667 3:108366464-108366486 TTTTGGAATCAGGATGATGCTGG + Intronic
960137925 3:114124342-114124364 TTTTAGAAACTGGATGTGGCAGG + Intergenic
960270321 3:115666812-115666834 ATTCAGAAGCTGGATGACGCTGG + Intronic
961115971 3:124330296-124330318 CTTCACACACAGGATGAGGCAGG - Intronic
961659026 3:128458585-128458607 TTTCAGAGCCAGGCTGAGGCTGG - Intergenic
961821929 3:129579566-129579588 ATTCGGGAGCAGGAGGAGGCAGG - Intronic
962020189 3:131491971-131491993 TTTCTGAAGCAGGGTGAGTCAGG - Intronic
962252485 3:133844639-133844661 GATCAAAAGCAGGACGAGGCAGG + Intronic
962386314 3:134935326-134935348 TGTCAGAAGAAAGATGAGCCTGG + Intronic
962639813 3:137373788-137373810 TTTCAGTATCAGGATGATGCTGG + Intergenic
963307183 3:143665986-143666008 CTTCAGTATCAGGATGATGCTGG - Intronic
964202619 3:154135067-154135089 TTTTAGTATCAGGATGATGCTGG + Intronic
964581530 3:158244610-158244632 TTTCAGTAACAGGATGATGCTGG + Intronic
964628694 3:158784863-158784885 CTTCAGAAGCAAGATGACACAGG - Intronic
964926581 3:161965087-161965109 GTTCAGAAGAAGGGTGAGTCTGG + Intergenic
965097927 3:164258038-164258060 TTTTAGTATCAGGATGATGCTGG - Intergenic
965123478 3:164594178-164594200 TTTCAGCTGCAGGAAGAGGGAGG + Intergenic
965442922 3:168738552-168738574 TTAGAGAAGCAGGACAAGGCAGG + Intergenic
965928084 3:174007851-174007873 TTGCACAAACATGATGAGGCTGG + Intronic
966331803 3:178823060-178823082 TTTCTGAATCAGGAAGAGACAGG - Intronic
966439650 3:179929706-179929728 TTTAGGGAGCAGGAAGAGGCAGG - Intronic
967343322 3:188425433-188425455 TTTTGGTAGCAGGATGATGCTGG + Intronic
967581565 3:191162267-191162289 TTTAAAAAGCATGATGTGGCTGG - Intergenic
968176812 3:196557642-196557664 TTTCAGATGCAGAAAGGGGCAGG + Intronic
969398668 4:6939282-6939304 TTTATGCAGCAGGAAGAGGCAGG - Intronic
970067280 4:12112909-12112931 TTTTGGAATCAGGGTGAGGCCGG + Intergenic
970101503 4:12527804-12527826 TTTTAGTATCAGGATGATGCTGG - Intergenic
970214202 4:13741888-13741910 TTTTAGAATCAGGATGATGCTGG + Intergenic
970653931 4:18210114-18210136 TTTCAGTATCAGAATGATGCCGG + Intergenic
970656514 4:18236385-18236407 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
970992888 4:22234094-22234116 TTTCTGAAGGAGGATCAGGGTGG - Intergenic
971974372 4:33664631-33664653 TTTTAGAATCAGGATGATGTTGG + Intergenic
972269720 4:37499307-37499329 TTTTGGTAGCAGGATGATGCTGG + Intronic
973269282 4:48244782-48244804 TTTGAGAAGAAGGATGTTGCAGG - Intronic
973629441 4:52805653-52805675 TTTGGGAATCAGGATGATGCTGG - Intergenic
973714888 4:53666295-53666317 TTTTAGTATCAGGATGATGCTGG + Intronic
974367789 4:60974538-60974560 TTTCGGTATCAGGATGATGCTGG + Intergenic
974642910 4:64654863-64654885 TTTCAGAAGCAGGAAGACAATGG - Intergenic
974912918 4:68145385-68145407 TTTCAGTATCAGGATGATGCTGG + Intergenic
975178255 4:71312427-71312449 TTTTCGAATCAGGATGATGCTGG - Intronic
975212619 4:71718916-71718938 TTTCGGTATCAGGATGATGCTGG + Intergenic
975865464 4:78719498-78719520 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
975875811 4:78835686-78835708 TCTGAGAAGAGGGATGAGGCAGG - Intronic
976007143 4:80443190-80443212 TTTTAGTATCAGGATGACGCTGG - Intronic
976036964 4:80835342-80835364 TTCAAGAAGCAGGCCGAGGCGGG - Intronic
976207930 4:82639892-82639914 TTTCAGAAGCAAGATGGGGGTGG - Intronic
977062050 4:92271718-92271740 TTTTTGAGCCAGGATGAGGCAGG + Intergenic
977320397 4:95507598-95507620 TTTCAGGACAAGGATGAGACAGG - Intronic
978023754 4:103847158-103847180 TTGTAGAATCAGGATGATGCTGG - Intergenic
978236569 4:106468038-106468060 TTTTGGAATCAGGATGATGCTGG + Intergenic
978544385 4:109855057-109855079 TTTTGGTAGCAGGATGATGCTGG + Intronic
979115605 4:116818702-116818724 TTTTGGAATCAGGATGATGCTGG - Intergenic
979124954 4:116957789-116957811 TGTCATATGCAGGATGAAGCTGG - Intergenic
979139436 4:117153318-117153340 TTGCACAGGAAGGATGAGGCAGG + Intergenic
979170808 4:117599490-117599512 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
979583553 4:122388353-122388375 TTTTAGTATCAGGATGATGCTGG + Intronic
979866616 4:125763358-125763380 TTCCAGAAACATGATGATGCTGG + Intergenic
979869928 4:125806254-125806276 CTTCAGTATCAGGATGATGCTGG + Intergenic
980332007 4:131422598-131422620 CTTCAGGATCAGGATGATGCTGG - Intergenic
980336205 4:131476807-131476829 TTTCTGTATCAGGATGATGCTGG - Intergenic
980732867 4:136845248-136845270 TTTTGGTAGCAGGATGATGCTGG + Intergenic
980769648 4:137354517-137354539 TTTCAGTATCAGGATGATGCTGG - Intergenic
981388630 4:144161284-144161306 TTTTAGTATCAGGATGATGCTGG + Intergenic
981402144 4:144325802-144325824 TTTTGGAATCAGGATGATGCTGG - Intergenic
981917664 4:150052278-150052300 GTACAGCAGAAGGATGAGGCTGG - Intergenic
982168245 4:152636048-152636070 CTCCAGAAGAAGGAAGAGGCTGG + Intronic
982413714 4:155108504-155108526 TTTCTGAGTCAGGATGAGCCAGG + Intergenic
982474983 4:155839403-155839425 TTCCAGAAGTAGGATGGGGAGGG + Intronic
982635528 4:157891738-157891760 GTTCAGTTGCAGGATGAGGGTGG - Intergenic
982811213 4:159827914-159827936 CTCCAGAAGCAGGGTGCGGCAGG + Intergenic
983978686 4:173968231-173968253 TTCCAGAAGAACGATCAGGCAGG - Intergenic
984525812 4:180858333-180858355 TTTTGGAATCAGGATGATGCTGG + Intergenic
984767921 4:183413739-183413761 TTTCAGGAGCAGGCTGAGCGCGG + Intergenic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
986208364 5:5647319-5647341 GTTCAGTAGAAGGATTAGGCTGG - Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
989324803 5:40179612-40179634 TTTTAGTATCAGGATGATGCTGG - Intergenic
989626838 5:43437809-43437831 TTAAAGAAGCAGGATGGGTCTGG + Intergenic
990734987 5:58850437-58850459 TTTCTGAAGGAGGTTGAAGCAGG + Intronic
990976505 5:61565836-61565858 GTTCAGGAGCATGAAGAGGCTGG - Intergenic
991110400 5:62893364-62893386 TTTTGGAATCAGGATGATGCTGG + Intergenic
991971310 5:72144429-72144451 TTTCAGAGACAGGATGGTGCAGG + Intronic
992161472 5:74008043-74008065 TTTCTCAAGCAGGATGATGAGGG - Intergenic
992254463 5:74907725-74907747 TTTCAGTATCAGGATGATGCTGG + Intergenic
992274600 5:75102271-75102293 TTCCAGAGGAAGGATCAGGCAGG - Intronic
992280338 5:75168578-75168600 TTTCATAATCAGCCTGAGGCAGG - Intronic
992854183 5:80843390-80843412 TTTTGGTATCAGGATGAGGCTGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993253676 5:85559689-85559711 TTTCGGTATCAGGATGATGCTGG - Intergenic
993291672 5:86080104-86080126 TTTTGGAATCAGGATGATGCTGG + Intergenic
994148370 5:96420334-96420356 TGTCTGAAGCAGGATAATGCAGG - Intronic
994345698 5:98683446-98683468 TTTTTGTATCAGGATGAGGCTGG - Intergenic
994470246 5:100194608-100194630 TTTCAGTGTCAGGATGATGCTGG - Intergenic
994545709 5:101163625-101163647 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
994636639 5:102352086-102352108 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
995005918 5:107195176-107195198 TCACACAAGCAGGATGACGCTGG + Intergenic
995177144 5:109192017-109192039 TTTCTGAATCGGTATGAGGCAGG - Exonic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995486505 5:112645278-112645300 TTTTAAAAGCAGAATGGGGCCGG + Intergenic
996060393 5:119026621-119026643 TTTTGGAATCAGGATGATGCTGG + Intergenic
996451652 5:123632386-123632408 TTTTGGAATCAGGATGATGCTGG - Intergenic
996454737 5:123667719-123667741 TTTTGGAATCAGGATGATGCTGG - Intergenic
996745884 5:126845481-126845503 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
996883135 5:128323777-128323799 TTTCGGTATCAGGATGATGCTGG + Intronic
997204753 5:132040191-132040213 TTTTGGTAGCAGGATGATGCTGG + Intergenic
997389453 5:133502021-133502043 TTCCAGAAGCTGGAAGGGGCAGG + Intronic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
997770891 5:136551798-136551820 TTTTTGAGCCAGGATGAGGCAGG + Intergenic
998021300 5:138773673-138773695 GTTTAGAAGCAGGATTAGGGAGG + Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000582440 5:163050495-163050517 TTTTAGTATCAGGATGATGCTGG - Intergenic
1001249623 5:170136733-170136755 TTTCCTAAGAATGATGAGGCAGG + Intergenic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1001820811 5:174708807-174708829 TTTGAGGAGGAGGAGGAGGCGGG - Intergenic
1002123805 5:177026305-177026327 CTTCAGAAACAAGATGAGGAAGG - Intronic
1002686142 5:181011669-181011691 TTTTGGAATCAGGATGATGCTGG - Intergenic
1002734032 5:181368969-181368991 TTTCAGAATCAGGGTAATGCTGG + Intergenic
1002750511 6:105153-105175 TTTCAGAATCAGGGTAATGCTGG - Intergenic
1002858644 6:1059804-1059826 TTTCAGAGGCCGGAGGAGCCTGG + Intergenic
1002941630 6:1721873-1721895 TTTCAGAAACAGGATCAGAAAGG + Intronic
1003009942 6:2417271-2417293 CATCAGAAGCTGGAAGAGGCAGG + Intergenic
1003282170 6:4703556-4703578 TCACACAAGCAGGATGATGCTGG + Intergenic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1003823727 6:9928901-9928923 TTTTAGTAGCAGAATGATGCTGG - Intronic
1004058049 6:12161173-12161195 TCTCAGAAGGGGAATGAGGCAGG - Intronic
1004283059 6:14297166-14297188 TTTTTGAGCCAGGATGAGGCAGG + Intergenic
1004283913 6:14302600-14302622 TTTTTGAGCCAGGATGAGGCAGG + Intergenic
1004717229 6:18229053-18229075 TTCCAGAGGAAGGATCAGGCAGG + Intronic
1004749888 6:18551488-18551510 TTCCAGTAGTAGGAGGAGGCTGG + Intergenic
1005795096 6:29351694-29351716 TTTTAGTATCAGGATGATGCTGG + Intergenic
1006104249 6:31707076-31707098 TGTCAGAGGCAGGAGGAGGTTGG - Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006584267 6:35096061-35096083 TGTCAGAAGTGGGATGAGGCAGG + Intergenic
1006622417 6:35375054-35375076 TTTCATAAACAGAATGTGGCTGG + Intronic
1007216066 6:40239207-40239229 TTTTAGTATCAGGATGATGCTGG - Intergenic
1007306013 6:40905594-40905616 TATCAGAAACATGGTGAGGCAGG + Intergenic
1007703539 6:43777990-43778012 TTTGGGAAGCTGGATGAGCCTGG + Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008332119 6:50257976-50257998 TTTTAGTATCAGGATGATGCTGG + Intergenic
1008652067 6:53573841-53573863 ATTTAAAAGAAGGATGAGGCAGG + Intronic
1008962944 6:57285279-57285301 TTTTGGAACCAGGATGATGCTGG - Intergenic
1008994238 6:57639889-57639911 TTTCAGAATCAGGATGATGCTGG - Intronic
1009182837 6:60539003-60539025 TTTCAGAATCAGGATGATGCTGG - Intergenic
1009246877 6:61249548-61249570 CTTCAGTATCAGGATGATGCTGG + Intergenic
1009570608 6:65379121-65379143 TTTTGGAATCAGGATGATGCTGG - Intronic
1009648861 6:66447210-66447232 TTTTGGTATCAGGATGAGGCTGG - Intergenic
1009717927 6:67424940-67424962 TTTTGGTAGCAGGATGATGCTGG + Intergenic
1011081952 6:83499298-83499320 CTTCAGTATCAGGATGATGCTGG - Intergenic
1011115142 6:83881471-83881493 TACAAGAAGCAGTATGAGGCTGG - Intronic
1011235270 6:85209635-85209657 TTTTAGTATCAGGATGAGACTGG + Intergenic
1011235823 6:85215455-85215477 TTTTGGTATCAGGATGAGGCTGG - Intergenic
1011770486 6:90670427-90670449 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1012066077 6:94554144-94554166 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1012077333 6:94707029-94707051 TTTCAGGAGAATGATGAGGGTGG + Intergenic
1012267050 6:97157805-97157827 TTTTAGTATCAGGATGATGCTGG + Intronic
1012679767 6:102165295-102165317 TTTTGGAATCAGGATGATGCTGG + Intergenic
1012679771 6:102165322-102165344 TTTTGGAATCAGGATGATGCTGG + Intergenic
1012743880 6:103057746-103057768 TTTTAGTATCAGTATGAGGCTGG + Intergenic
1012839706 6:104314441-104314463 GTTCTGAAGCAGGATGAAGGGGG - Intergenic
1012870431 6:104666814-104666836 TTTCAGAATCAGGGTGATGCTGG - Intergenic
1013003275 6:106046297-106046319 TTTCAGAAGAAGGAGGTGGTTGG + Intergenic
1013333746 6:109134067-109134089 TTTTGGTAGCAGGATGATGCTGG - Intronic
1013930056 6:115519749-115519771 TTTCAGTATCAGGATGATGCTGG - Intergenic
1014223200 6:118819606-118819628 TTTTGGAATCAGGATGATGCTGG + Intronic
1014317304 6:119883952-119883974 CTTGAGAAGAAGGATGAGTCTGG + Intergenic
1014344488 6:120250872-120250894 TTTGGGAATCAGGATGATGCTGG - Intergenic
1014731802 6:125040594-125040616 TTTTGGAATCAGGATGATGCTGG - Intronic
1014846487 6:126283720-126283742 TTTTGGAATCAGGATGACGCTGG - Intergenic
1014928092 6:127298985-127299007 TTCCTGAGGGAGGATGAGGCAGG - Intronic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1015270099 6:131328890-131328912 TTTCTGAGCCAGGATGAGCCAGG - Intergenic
1015386380 6:132628927-132628949 TTTCAATATCAGGATGATGCTGG + Intergenic
1015902222 6:138079601-138079623 TTTTAGTATCAGGATGATGCTGG - Intergenic
1016235886 6:141865744-141865766 TTGCAGAAACAGGATGAAGCTGG + Intergenic
1016288673 6:142504141-142504163 TTTCAGTAGCAGGATGATGCTGG + Intergenic
1016302646 6:142649700-142649722 TTTCTGAGCCAGGATGAGCCAGG - Intergenic
1016761098 6:147738512-147738534 TTTCAAATGCATGTTGAGGCTGG + Intergenic
1016778118 6:147928153-147928175 TTTTTGAATCAGGATGATGCTGG + Intergenic
1016875792 6:148863842-148863864 TTCCAGAAGAAGGATCAGGCAGG - Intronic
1017630219 6:156389688-156389710 CTCCAGAAACAAGATGAGGCTGG + Intergenic
1018144324 6:160869138-160869160 TTTTGGAATCAGGATGATGCTGG + Intergenic
1019238278 6:170641287-170641309 TTTCAGAATCAGGGTAATGCTGG + Intergenic
1019742832 7:2683313-2683335 CCCCAGAAGCAGGAAGAGGCAGG - Intronic
1019769580 7:2875281-2875303 TTCCAGAAGCAGGAAGAGACAGG - Intergenic
1020252951 7:6483992-6484014 CTTCAGCAGCAGGATGACGATGG + Exonic
1020634299 7:10677886-10677908 TTTAAGAAGCTGGAGGAAGCAGG + Intergenic
1021520311 7:21533265-21533287 TTTTAGTATCAGGATGATGCTGG + Intergenic
1021943368 7:25701778-25701800 TTTCGGTATCAGGATGATGCTGG + Intergenic
1022273511 7:28833286-28833308 TTTAAAAATCATGATGAGGCTGG - Intergenic
1022498217 7:30866380-30866402 TTCCAGGAGCTGGAAGAGGCAGG - Intronic
1022534508 7:31087444-31087466 TTTCAGAGCCAGGACCAGGCTGG + Intronic
1022611743 7:31882322-31882344 TTTCAGAGGCAGCACGAGACAGG + Intronic
1022652410 7:32289296-32289318 ACTCAGAGGCAGGCTGAGGCAGG + Intronic
1022677657 7:32514687-32514709 TTTCTGAGCCAGGATGAGCCAGG - Intronic
1022818700 7:33937926-33937948 TTCCAGAAGGAGCATGTGGCTGG - Intronic
1022885231 7:34636528-34636550 TTTTAGTATCAGGATGATGCTGG - Intergenic
1023308148 7:38853121-38853143 TTTCATAAGAAGAATGTGGCCGG + Intronic
1023697363 7:42861598-42861620 TTTTGGAATCAGGATGATGCTGG + Intergenic
1023818505 7:43967606-43967628 TTTGGGAAGGAGGCTGAGGCAGG + Intergenic
1023894680 7:44422799-44422821 TTTTGGAATCAGGATGATGCTGG - Intronic
1023934904 7:44732788-44732810 TACCAGATGCAGGAGGAGGCAGG + Intergenic
1024590306 7:50876034-50876056 TTTTAGTATCAGGATGATGCTGG - Intergenic
1024625179 7:51201945-51201967 TGTCCCAGGCAGGATGAGGCAGG - Intronic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1025062796 7:55825668-55825690 TTTAAAAAGAAGGATGGGGCCGG + Intronic
1025714801 7:63945245-63945267 TTTTGGAATCAGGATGATGCTGG - Intergenic
1025839905 7:65136503-65136525 TTTAAAAAACATGATGAGGCCGG - Intergenic
1025883161 7:65559462-65559484 TTTAAAAAACATGATGAGGCCGG + Intergenic
1025890285 7:65643144-65643166 TTTAAAAAACATGATGAGGCCGG - Intergenic
1026087261 7:67272565-67272587 TTTAAGAAGCAGGTGGCGGCAGG - Intergenic
1026125988 7:67579974-67579996 TTTCACAAGCAGGCAGAAGCAGG - Intergenic
1026689839 7:72542136-72542158 TTTAAGAAGCAGGTGGCGGCAGG + Intergenic
1026775189 7:73226788-73226810 CTCCAGAAGGAGGAAGAGGCCGG + Intergenic
1027016046 7:74780159-74780181 CTCCAGAAGGAGGAAGAGGCCGG + Intronic
1027071983 7:75165778-75165800 CTCCAGAAGGAGGAAGAGGCCGG - Intergenic
1027299416 7:76814901-76814923 TTTTGGAAACAGGATGATGCTGG + Intergenic
1027357038 7:77367687-77367709 TTTCAGTATCAGGATGATGCTGG + Intronic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1029743549 7:102504567-102504589 TTTGGGAAGGAGGCTGAGGCAGG + Intronic
1029761538 7:102603726-102603748 TTTGGGAAGGAGGCTGAGGCAGG + Intronic
1029844813 7:103402046-103402068 TTTTGGTAGCAGGATGATGCTGG + Intronic
1029855190 7:103508189-103508211 TTTTGGTAGCAGGATGATGCTGG - Intronic
1030169599 7:106588241-106588263 TTTGAGAAAGAGGATGGGGCAGG - Intergenic
1030855494 7:114550410-114550432 CTTCAAAAGAAAGATGAGGCCGG - Intronic
1031703023 7:124948477-124948499 TTTCGGTATCAGGATGATGCTGG - Intergenic
1031852194 7:126878864-126878886 TTTAAAAAACATGATGAGGCCGG + Intronic
1031915544 7:127559682-127559704 GTTCAGAAGAAGGTGGAGGCTGG - Intergenic
1032003220 7:128280040-128280062 TTTTAGTATCAGGATGATGCTGG + Intergenic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1032240947 7:130158386-130158408 TTTCAGTAGGAGGAAGAAGCAGG - Intergenic
1032419174 7:131764293-131764315 TGACAGAAGCAGGAGCAGGCTGG - Intergenic
1034365827 7:150546302-150546324 TTTTAGTATCAGGATGATGCTGG - Intergenic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035509491 8:165320-165342 TTTCAGAATCAGGGTAATGCTGG - Intergenic
1037257936 8:16976330-16976352 TTTTGGTATCAGGATGAGGCTGG + Intergenic
1037750805 8:21680970-21680992 TTTAAGTAGGAGGGTGAGGCTGG + Intergenic
1037871925 8:22506138-22506160 TTTAAAAAGCAGCATGAGCCAGG + Intronic
1038679816 8:29656327-29656349 TTCAAGGAGGAGGATGAGGCAGG - Intergenic
1039068019 8:33626375-33626397 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1039372608 8:37001984-37002006 TTTTAGAAGCCGGAAAAGGCAGG - Intergenic
1039424106 8:37471472-37471494 CGTCAGCAGCAGGCTGAGGCTGG + Intergenic
1039430172 8:37519689-37519711 TCTCAGTATCAGGATGAGGCAGG - Intergenic
1039873606 8:41567381-41567403 GTTCTGCAGCAGGAGGAGGCCGG - Intergenic
1040106562 8:43545367-43545389 TTTCAGGAGGACGTTGAGGCAGG - Intergenic
1040106925 8:43546676-43546698 TTTCAGAAGGACATTGAGGCAGG - Intergenic
1040107644 8:43549533-43549555 TTTCAGAAGGATGTTGAGGCAGG - Intergenic
1040296261 8:46150666-46150688 ACTCAGAAGGATGATGAGGCAGG - Intergenic
1040717048 8:50268953-50268975 TTTCAAAAACTGGTTGAGGCTGG - Intronic
1041090065 8:54293613-54293635 TTACAGTAGGAGGCTGAGGCAGG + Intergenic
1041120206 8:54578917-54578939 TCTAAGAAGGGGGATGAGGCAGG - Intergenic
1041470834 8:58207098-58207120 TTTTGGTATCAGGATGAGGCTGG + Intergenic
1041625071 8:60016084-60016106 TTACAGATGCCAGATGAGGCTGG + Intergenic
1042779836 8:72479190-72479212 TTTTGGAATCAGGATGATGCTGG - Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1043619480 8:82171075-82171097 TTTTGGTAGCAGGATGATGCTGG + Intergenic
1044401958 8:91783077-91783099 TTTGAGAATCAGGAAGAGACAGG - Intergenic
1045212861 8:100116917-100116939 TTTTAGTATCAGGATGATGCTGG - Intronic
1045496902 8:102716811-102716833 GTTCAGAGGCACGATGAGGGAGG + Intergenic
1045774141 8:105781830-105781852 TTTATGAAGCAGCATTAGGCAGG - Intronic
1046114923 8:109773417-109773439 CTTCAGGATCAGGATGATGCTGG + Intergenic
1046258229 8:111729157-111729179 CTTCAGTAGCAGCAAGAGGCAGG - Intergenic
1046442837 8:114281900-114281922 TTTCTGAGCCAGGATGAGCCAGG - Intergenic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1046781024 8:118215185-118215207 TTTCAGAAACAGGAGTGGGCTGG - Intronic
1046908195 8:119597022-119597044 ATTCAGATGCAGGAAGGGGCGGG + Intronic
1047602868 8:126444335-126444357 CTCCAGAAGGAGGCTGAGGCAGG - Intergenic
1047789100 8:128184418-128184440 TATCAGAAGGGAGATGAGGCAGG - Intergenic
1048043654 8:130753771-130753793 TTTCTGAAGCAGAGGGAGGCTGG - Intergenic
1048690988 8:136963147-136963169 TTTCGGTATCAGGATGATGCTGG + Intergenic
1049018379 8:139937508-139937530 CTTCAGGAGCAGGCGGAGGCTGG + Intronic
1049812725 8:144582681-144582703 CTGCAGGAGGAGGATGAGGCGGG + Intronic
1049889846 9:58536-58558 TGCCAGAAGCTGGAAGAGGCAGG + Intergenic
1050270483 9:3939214-3939236 TTTCAGCACCAGGATGAGAGCGG + Intronic
1050282566 9:4066415-4066437 TTTCACAACCAGGAGGTGGCTGG - Intronic
1050852396 9:10303918-10303940 TTTCAGCATCAGGATGATGCTGG - Intronic
1050966112 9:11804971-11804993 CTTCAGTATCAGGATGATGCTGG + Intergenic
1051068092 9:13129164-13129186 TCAGAAAAGCAGGATGAGGCTGG + Intronic
1051422889 9:16906008-16906030 TTGCAGAAGCTGGCTGGGGCTGG - Intergenic
1051491586 9:17672859-17672881 ATTCTGAAACAGAATGAGGCTGG - Intronic
1051801200 9:20936447-20936469 TTTCAGATGCAGGCTGAGATTGG + Intronic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053615196 9:39758498-39758520 TTTCAGGAACATGATGAAGCTGG + Intergenic
1053731325 9:41059811-41059833 TGCCAGAAGCTGGAAGAGGCAGG + Intergenic
1053873364 9:42517762-42517784 TTTCAGGAACATGATGAAGCTGG + Intergenic
1053899385 9:42778158-42778180 TTTCAGGAACATGATGAAGCTGG - Intergenic
1054238323 9:62583892-62583914 TTTCAGGAACATGATGAAGCTGG - Intergenic
1054262268 9:62879418-62879440 TTTCAGGAACATGATGAAGCTGG + Intergenic
1054268965 9:62948990-62949012 TTTCAGGAACATGATGAAGCTGG - Intergenic
1054552453 9:66618412-66618434 TTTCAGGAACATGATGAAGCTGG - Intergenic
1054697182 9:68372278-68372300 TGCCAGAAGCTGGAAGAGGCGGG - Intronic
1054985895 9:71261853-71261875 TTTCAGAGGAAGGAGCAGGCAGG - Intronic
1055233522 9:74091163-74091185 TTTCTGAGTCAGGATGAGCCAGG - Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055537594 9:77265282-77265304 TTTTGGTAGCAGGATGAGGCTGG + Intronic
1055779549 9:79804915-79804937 CTTCACAAGCAGGAAGAGGCAGG - Intergenic
1055895163 9:81166087-81166109 TTTTGGTAGCAGGATGATGCTGG - Intergenic
1056925510 9:90830879-90830901 TTTCATAAGAAAGAGGAGGCCGG - Intronic
1057493859 9:95544337-95544359 TTTCAGAAGCAGTAAGAGACTGG - Intergenic
1057753665 9:97811965-97811987 TTTCAGAGCCAGGATGAAGGGGG - Intergenic
1057879800 9:98784576-98784598 TTTCAGATGCAGGAAGAGCTAGG + Intronic
1058092905 9:100825928-100825950 TTTTAGTATCAGGATGATGCTGG + Intergenic
1058266323 9:102903387-102903409 TTTTGGAATCAGGATGATGCTGG - Intergenic
1059060108 9:111027013-111027035 TTTTAGTATCAGGATGATGCTGG + Intronic
1059063155 9:111054352-111054374 GTTGAGAAGCAGGATAGGGCAGG - Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059575048 9:115478672-115478694 TTTCTGAGCCAGGATGAGCCAGG - Intergenic
1059895459 9:118859266-118859288 TTTTGGTATCAGGATGAGGCTGG - Intergenic
1060378049 9:123136339-123136361 TTTGAGAAGAAAGATAAGGCTGG + Intronic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1062357857 9:136173517-136173539 CATCAGAAGCTGGAAGAGGCAGG + Intergenic
1062613510 9:137385997-137386019 TTTTAAAAGCAGGGTGAAGCTGG + Intronic
1062758483 9:138321579-138321601 TTTCAGAATCAGGGTAATGCTGG + Intergenic
1185718271 X:2360921-2360943 TTTCAGAGGAAGGATGGAGCTGG + Intronic
1188499723 X:30811857-30811879 TTATAAAAGAAGGATGAGGCAGG - Intergenic
1188725203 X:33574402-33574424 TTTTAGTATCAGGATGATGCTGG + Intergenic
1189928143 X:45978860-45978882 TTTCAGCAGCATGGTGTGGCTGG - Intergenic
1190114964 X:47620224-47620246 TTTTAGGACCAGGATGAGGCGGG - Intergenic
1190522613 X:51295664-51295686 TTTCAGAGGTAGGAAGGGGCAGG - Intergenic
1190525841 X:51328843-51328865 TTTCAGAATTAGGAAGGGGCAGG - Intergenic
1190543636 X:51502819-51502841 TTTCAGAATTAGGAAGGGGCAGG + Intergenic
1190686541 X:52879297-52879319 TATCAGCATCAGGATGATGCTGG - Intergenic
1191061771 X:56305656-56305678 TTTTAGTATCAGGATGATGCTGG + Intergenic
1191254661 X:58274555-58274577 TTTCAGAGGGAGGTTGAGGCAGG - Intergenic
1191254770 X:58274949-58274971 TTTCAAAGGGAGGTTGAGGCAGG - Intergenic
1191254918 X:58275533-58275555 TTTCAGGGGGAGGTTGAGGCAGG - Intergenic
1191255397 X:58277488-58277510 TTTCAGTGGGAGGTTGAGGCAGG - Intergenic
1191255553 X:58278107-58278129 TTTCAGGAGGAGGTTGAGACTGG - Intergenic
1191255700 X:58278682-58278704 TTTCAGAGGGAGGTTGAGGCAGG - Intergenic
1191255863 X:58279336-58279358 TTACAAAAGCAGCTTGAGGCAGG - Intergenic
1191256544 X:58282005-58282027 TTTCAGAAGGAGGTTGAAGCAGG - Intergenic
1191256696 X:58282574-58282596 TTTCAGGAGGAGGTTGAGGCAGG - Intergenic
1191257294 X:58285160-58285182 TTTCAAAGGGAGGTTGAGGCAGG - Intergenic
1191257347 X:58285377-58285399 TTTCAGGAGGAGGTTGAGGGAGG - Intergenic
1191257404 X:58285595-58285617 TTTCAGGGGGAGGTTGAGGCAGG - Intergenic
1191651457 X:63542588-63542610 TTTTAGTATCAGGATGATGCTGG - Intergenic
1191802983 X:65101888-65101910 TTTTGGAATCAGGATGATGCTGG - Intergenic
1191874726 X:65784623-65784645 TTTCAGAGGCATTATGAGGAAGG - Intergenic
1191928398 X:66341148-66341170 TTTTGGAATCAGGATGATGCTGG + Intergenic
1192311355 X:70017363-70017385 TTTTGGTAGCAGGATGATGCTGG - Intronic
1192635645 X:72814005-72814027 TTTTGGAATCAGGATGATGCTGG + Intronic
1192646069 X:72906798-72906820 TTTTGGAATCAGGATGATGCTGG - Intronic
1192748813 X:73966415-73966437 TTACAGCAGGAGGAAGAGGCAGG - Intergenic
1192822939 X:74663711-74663733 TTTTAAAGGCAGGAAGAGGCTGG + Intergenic
1193035712 X:76948880-76948902 TTTTAGTATCAGGATGATGCTGG + Intergenic
1193154828 X:78160911-78160933 TTTCTGAGCCAGGATGAGCCAGG + Intergenic
1193171218 X:78338244-78338266 TTTTGGTATCAGGATGAGGCTGG + Intergenic
1193334975 X:80277397-80277419 TTTTGGAATCAGGATGATGCTGG - Intergenic
1193340983 X:80349144-80349166 TTTTGGAATCAGGATGATGCTGG + Intronic
1193404799 X:81087568-81087590 TTTCGGCATCAGGATGATGCTGG - Intergenic
1193979648 X:88166134-88166156 TTTTAGAATCAGAATGATGCTGG + Intergenic
1194211051 X:91069580-91069602 TTTTGGTATCAGGATGAGGCTGG - Intergenic
1194228848 X:91296999-91297021 TTTTAGTATCAGGATGATGCTGG + Intergenic
1194515006 X:94841695-94841717 TTTTGGAATCAGGATGATGCTGG + Intergenic
1194540233 X:95160844-95160866 TTTTAGTATCAGGATGATGCTGG - Intergenic
1194631633 X:96292423-96292445 TTTTGGAATCAGGATGATGCTGG - Intergenic
1194811605 X:98394321-98394343 TTTTAGTATCAGGATAAGGCTGG - Intergenic
1195104399 X:101589794-101589816 TTTCAGTATCAGGATGATGGTGG + Intergenic
1195685940 X:107585928-107585950 TTTGAGTATCAGGATGATGCTGG + Intronic
1195855521 X:109328141-109328163 TTTTGGAATCAGGATGATGCTGG + Intergenic
1195932787 X:110096025-110096047 TTCCAGAGGAAGGATCAGGCAGG - Intronic
1196019198 X:110972352-110972374 TTCCAGAGGAAGGATCAGGCAGG + Intronic
1196473429 X:116054950-116054972 TTTCAGAATCAGGATGATGGTGG + Intergenic
1196746701 X:119077633-119077655 TTTCTAAAGCAGGAGGAGGAAGG + Intergenic
1196973350 X:121133070-121133092 TCTCAGAGGGAAGATGAGGCAGG - Intergenic
1197029767 X:121799625-121799647 TTTTGGTATCAGGATGAGGCTGG + Intergenic
1197191428 X:123651954-123651976 TTTTAGTATCAGGATGATGCTGG - Intronic
1197482894 X:127008944-127008966 TTTCGGTATCAGGATGATGCTGG - Intergenic
1197579014 X:128258612-128258634 TTTCAGTACCAGGATGATACTGG - Intergenic
1198060230 X:133038648-133038670 TTTTGGAATCAGGATGATGCTGG + Intronic
1198392870 X:136193961-136193983 TTCAAGAAGCAGGATGCAGCTGG - Intronic
1198408040 X:136335368-136335390 TTTCAGTATCAGGATGACACTGG + Intronic
1198584581 X:138106057-138106079 TTCCAGAGGAAGGATCAGGCAGG + Intergenic
1198678983 X:139161000-139161022 TTTTGGTAGCAGGATGATGCTGG - Intronic
1198758328 X:140004101-140004123 TTTTGGAATCAGGATGATGCTGG - Intergenic
1198789958 X:140334227-140334249 TTTTAGTATCAGGATGATGCTGG - Intergenic
1199122840 X:144077347-144077369 GGTCAGAAGTGGGATGAGGCCGG - Intergenic
1199253457 X:145691535-145691557 TTTCAGTATCAGGATATGGCAGG + Intergenic
1199939553 X:152611945-152611967 TTCCAGAGGTAGGATCAGGCAGG - Intergenic
1200813834 Y:7511422-7511444 TTTTAGTATCAGGATGATGCTGG + Intergenic
1201520420 Y:14867258-14867280 TTTTAGTATCAGGATGATGCTGG - Intergenic
1202335326 Y:23802842-23802864 TTTTAGTATCAGGATGATGCTGG - Intergenic
1202357001 Y:24062285-24062307 TTTCAGTATCAGGATGATGCTGG - Intergenic
1202513776 Y:25607829-25607851 TTTCAGTATCAGGATGATGCTGG + Intergenic
1202535441 Y:25867217-25867239 TTTTAGTATCAGGATGATGCTGG + Intergenic