ID: 998165626

View in Genome Browser
Species Human (GRCh38)
Location 5:139841413-139841435
Sequence GTAAGCCAAGTGTTCATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 1, 2: 13, 3: 59, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998165626_998165630 21 Left 998165626 5:139841413-139841435 CCATCAATGAACACTTGGCTTAC 0: 1
1: 1
2: 13
3: 59
4: 323
Right 998165630 5:139841457-139841479 AAAAATGCTGTTATGAAAATGGG 0: 1
1: 3
2: 71
3: 660
4: 2845
998165626_998165629 20 Left 998165626 5:139841413-139841435 CCATCAATGAACACTTGGCTTAC 0: 1
1: 1
2: 13
3: 59
4: 323
Right 998165629 5:139841456-139841478 GAAAAATGCTGTTATGAAAATGG 0: 1
1: 3
2: 57
3: 538
4: 2111
998165626_998165627 -10 Left 998165626 5:139841413-139841435 CCATCAATGAACACTTGGCTTAC 0: 1
1: 1
2: 13
3: 59
4: 323
Right 998165627 5:139841426-139841448 CTTGGCTTACTTCCATCTTTTGG 0: 1
1: 3
2: 50
3: 314
4: 1177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998165626 Original CRISPR GTAAGCCAAGTGTTCATTGA TGG (reversed) Intronic
901486243 1:9564511-9564533 GCAACCCAAGTGTCCATCGATGG + Intronic
902685490 1:18074244-18074266 GCAACCCAGGCGTTCATTGACGG + Intergenic
903269783 1:22180362-22180384 GTAACCCAAGTGTCCATCAATGG + Intergenic
903748917 1:25607268-25607290 GCAAACCAAGTGTGCATCGATGG + Intergenic
904106946 1:28092930-28092952 GCAACCCAAATGTTCATTGATGG + Intergenic
904946152 1:34200239-34200261 CTAAGCCATGTGCTCACTGAAGG + Intronic
905064485 1:35168528-35168550 TCAATCCAAGTGTCCATTGATGG + Intergenic
905765840 1:40599987-40600009 GCAACCCAAGTGTCCACTGAGGG - Intergenic
905981269 1:42230938-42230960 GCAGTCCAAGTGTGCATTGAAGG + Intronic
907131091 1:52097709-52097731 GTAACTCAAGTGCCCATTGATGG + Intergenic
907783920 1:57593403-57593425 AGAACCCAAGTGTTCATTGATGG - Intronic
907982090 1:59493382-59493404 GCAAACCAAGTGTTCATTAGTGG + Intronic
908330436 1:63065442-63065464 GCAAATCAAATGTTCATTGATGG + Intergenic
908475632 1:64484875-64484897 GCAAGCCAAGTGTCCATTGATGG - Intronic
908533436 1:65055400-65055422 GCAACCCAAGTGTCCATTGATGG - Intergenic
909620377 1:77660608-77660630 GCAACCCAAGTGTCCATTAATGG - Intronic
910372241 1:86528589-86528611 ACAACCAAAGTGTTCATTGATGG - Intergenic
911123276 1:94317005-94317027 GCAACCCAAATGTTCATGGATGG + Intergenic
911674263 1:100641323-100641345 GCAACTCAAGTGTCCATTGATGG + Intergenic
912586259 1:110769127-110769149 GCAATCCAAGTGTCCATTGATGG - Intergenic
912911740 1:113767715-113767737 GCAACCCAAGTGTCCACTGATGG + Intronic
913429460 1:118774872-118774894 GCAACCCAAGTTTTCGTTGATGG - Intergenic
914687505 1:149993966-149993988 ATAGGCCAAGTTTTCAGTGAAGG + Intronic
914705720 1:150168206-150168228 GCAACTCAAGTGTCCATTGATGG + Intergenic
918123547 1:181560830-181560852 GCAACCCAAGTGTTCACTGATGG + Intronic
918959628 1:191256767-191256789 GAAACCCAAGTGTCCATTTAAGG + Intergenic
919192030 1:194232994-194233016 GTAGGCCATGTGTTCCTTCATGG - Intergenic
920410100 1:205752497-205752519 GCAACCCAAGTGTCCATTGATGG - Intergenic
920461939 1:206147277-206147299 GTAAGGCCAGTTTTCATGGATGG + Intergenic
920513997 1:206570797-206570819 GAAACCCAAGTGTCCACTGATGG - Intronic
920514001 1:206570822-206570844 GCAACCCAAGGGTCCATTGATGG - Intronic
921323327 1:213965418-213965440 TTTATCCAGGTGTTCATTGATGG + Intergenic
921650991 1:217677964-217677986 ATAACCCAAGTTTTCATTGTAGG - Intronic
921793480 1:219316635-219316657 GCAACCCATGTGTCCATTGATGG + Intergenic
922176032 1:223198415-223198437 GCAACCCAAGTGTCCATTGACGG + Intergenic
922322031 1:224496966-224496988 GCAACTCAAGTGTTCTTTGATGG + Intronic
922431235 1:225556112-225556134 ATAATCCAATTGTTCATTAATGG - Intronic
923379548 1:233401969-233401991 GCAACCCAAGTGTCCATAGATGG + Intergenic
924210400 1:241760116-241760138 GCAACCCAAGTATCCATTGATGG - Intronic
1062984933 10:1759909-1759931 CTCAGCCAAGTGTTCCTTGAAGG + Intergenic
1063477191 10:6339678-6339700 GTAACCCCAGTGTCCACTGATGG + Intergenic
1063554895 10:7069017-7069039 GCAGGCTAAGTGTTAATTGAAGG - Intergenic
1064266378 10:13828843-13828865 TTTATCCAAGTGTCCATTGATGG + Intronic
1065762511 10:28995250-28995272 ATCAGCCAAATGTCCATTGATGG - Intergenic
1066110588 10:32192882-32192904 GCAACCCAAATGTCCATTGATGG - Intergenic
1066141029 10:32504438-32504460 TTAAGCCAATAGTTCATAGAAGG - Intronic
1066454681 10:35562714-35562736 GTAACCCAAGTGTCCATGGGTGG - Intronic
1069555776 10:69397057-69397079 GCAAGCCAAGTGTCCATGGATGG - Intronic
1069754858 10:70767931-70767953 ACAACCCAAGTGTCCATTGATGG + Intergenic
1069963799 10:72096656-72096678 GCAAGCCAAGTGTTCACTGATGG + Exonic
1070024030 10:72614466-72614488 GCAACCCAAGTGTCCACTGATGG + Intronic
1070169823 10:73924573-73924595 GTAAGCCATCTGTTTATTGGTGG - Intergenic
1070356973 10:75649348-75649370 GTAACCCAACTGTTCACTGATGG - Intronic
1070627726 10:78063104-78063126 CTATGCCAAGAGTTCTTTGAGGG - Intergenic
1072908079 10:99473555-99473577 GCAACCCAAGTGTCCATTGCTGG - Intergenic
1072976082 10:100059833-100059855 GCAACCCAAGTGTCCATTGGTGG + Intronic
1073887422 10:108056110-108056132 GCAATCCAAGTGTCTATTGATGG + Intergenic
1074488676 10:113917074-113917096 GTAATACAAGTGATCATAGAAGG + Exonic
1076148068 10:128140974-128140996 GAAAGACAAGTTTTCATTAATGG + Intergenic
1077216657 11:1397918-1397940 TTAAGCCAAGTGGGCAGTGATGG - Intronic
1079889887 11:26038435-26038457 CTAAGCCAAAAGGTCATTGAGGG + Intergenic
1080300582 11:30780488-30780510 ACAACCCAAATGTTCATTGATGG - Intergenic
1080354071 11:31420945-31420967 GTAAACCCAGTGCTCACTGAAGG - Intronic
1081770451 11:45647354-45647376 GCAACCCAAGTGTTCATCTAGGG + Intergenic
1082053552 11:47793639-47793661 GCAATCCAAGTGTCCATTGATGG + Intronic
1082935947 11:58656830-58656852 GCAATCCAAGTGTCCATAGATGG - Intronic
1084570614 11:69957436-69957458 GCAACCCAAGTGTGCATTGATGG - Intergenic
1086096623 11:83056424-83056446 GCAACCCAAGTGCCCATTGATGG - Intronic
1088307931 11:108429733-108429755 GCAACCCAAGTGTCCATTGGTGG + Intronic
1088781684 11:113141083-113141105 GTAAGCCAGCTGTTCATTTAGGG + Intronic
1088884688 11:113997607-113997629 GTAATCCATGTGTTTATTGTTGG + Intergenic
1089929095 11:122291369-122291391 GCAAACCAAGTGTCCATGGATGG + Intergenic
1089944854 11:122458936-122458958 GCAACACAAGTGTTCACTGATGG + Intergenic
1090054564 11:123411318-123411340 GTAGGTTATGTGTTCATTGAGGG + Intergenic
1091958123 12:4665481-4665503 GAAATCCAAGTATCCATTGATGG - Intronic
1093151391 12:15625829-15625851 CTAAGCACAGTGGTCATTGATGG - Intronic
1096766652 12:53896383-53896405 GTAAGACAAGTGTTGTCTGAAGG + Intergenic
1097956501 12:65491901-65491923 GCAACCCGAGTGTTCATTAATGG + Intergenic
1099036617 12:77595149-77595171 ATAACCCAAGTGTTCATTGATGG + Intergenic
1099286681 12:80721505-80721527 GAAACCCAAGTGTTCACTGCAGG - Intergenic
1099776818 12:87143935-87143957 GCAATCCAAGTTTGCATTGATGG + Intergenic
1099800409 12:87450503-87450525 ACAACCTAAGTGTTCATTGATGG + Intergenic
1100381030 12:94062125-94062147 GCAACCCAGGTGCTCATTGATGG + Intergenic
1100711614 12:97263276-97263298 GTAATTCAAATGTTCATTGTGGG - Intergenic
1101014388 12:100484495-100484517 GTAACCTAAGTCTTCATTTAAGG - Intronic
1101241022 12:102840250-102840272 GTAAGCCATGGGTTCATTGATGG - Intronic
1101901823 12:108796594-108796616 GCAACCCATGTGTTCATTGATGG - Intronic
1102698696 12:114820017-114820039 GCAACCCACGTGTCCATTGATGG - Intergenic
1102900717 12:116634414-116634436 GCAACCCAAGTGTTCACCGATGG + Intergenic
1103262531 12:119600530-119600552 GTCACCCAAGTGTCCATCGATGG + Intronic
1103306011 12:119964652-119964674 GTGAGCCAAGTGTCCCTCGATGG - Intergenic
1105494308 13:20917047-20917069 GTAACCCAAATGTCCATTGAGGG + Intergenic
1105693606 13:22865988-22866010 ATAAACTAAGTGTCCATTGATGG - Intergenic
1106198177 13:27511879-27511901 GCAATCCAAGTGTCCATTGCTGG - Intergenic
1106198596 13:27515995-27516017 GTAACCCAAGTGTCCATTGATGG + Intergenic
1106200267 13:27530507-27530529 ACAACCCAAGTGTCCATTGATGG - Intergenic
1107606896 13:42066270-42066292 GCAACCCAACTGTTCACTGATGG + Intronic
1107640475 13:42438147-42438169 GAAACCCAAGTGTTCATCAAAGG - Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1108495729 13:51023278-51023300 GAAATCCAACTGTCCATTGATGG + Intergenic
1109607172 13:64711711-64711733 GTAATCTAAGTGTTCATCAATGG - Intergenic
1112088659 13:96057861-96057883 GCAACCCAAGTGTCCATGGACGG - Intergenic
1112386973 13:98948949-98948971 GCAACCCAAGTGTCCATCGAGGG - Intronic
1113507425 13:110826879-110826901 CTATGCCAAGTGTCCAGTGATGG + Intergenic
1114578206 14:23732200-23732222 GTAAGCCAAGAGTTCTTAGCAGG - Intergenic
1114992823 14:28309691-28309713 GTGAGCCAAGTGTTCTGTGAGGG - Intergenic
1116539115 14:46075830-46075852 TCAAGCTAGGTGTTCATTGATGG - Intergenic
1116783465 14:49262950-49262972 GCAAGCCAAGTGGTCACTGAAGG - Intergenic
1117003032 14:51390978-51391000 GCAACCCAAGCGTCCATTGAGGG + Intergenic
1117054710 14:51899908-51899930 GCAACCCAAGTGTCCATTGATGG - Intronic
1117663341 14:58030872-58030894 GTACCCCGAGTGTCCATTGATGG - Intronic
1118508791 14:66446837-66446859 ACAAGCCAAGAGTTCCTTGAGGG - Intergenic
1118622740 14:67628964-67628986 GCAACCCAAGTGTCCATTGATGG + Intronic
1118794103 14:69124225-69124247 ATAACCCAAATGGTCATTGATGG - Intronic
1118885458 14:69862097-69862119 GCAATCCAAGTGTTCATTGATGG - Intronic
1122254320 14:100465606-100465628 GTAATCCAAGTGTCTATGGATGG - Intronic
1124414278 15:29462148-29462170 GCAACCCAAGCGTCCATTGATGG - Intronic
1124566735 15:30822842-30822864 GTAAGTCACGTGTTCTTTGATGG + Intergenic
1124591109 15:31053826-31053848 GCAACCCAAGTGTCCACTGATGG + Intronic
1125558596 15:40608040-40608062 GCAACTCAAGTGTCCATTGATGG + Intronic
1126919812 15:53508764-53508786 GCAACCCAAGTGTCTATTGATGG - Intergenic
1127676179 15:61241532-61241554 GTAAGCAAAGGGATCTTTGAGGG + Intergenic
1128643452 15:69357625-69357647 GCAACCGAAGTGTTCATTAAAGG - Intronic
1128825117 15:70708015-70708037 ATAATCCAAATGTCCATTGATGG + Intronic
1129100754 15:73260650-73260672 TTAAGCCAAGTCTAAATTGAGGG - Intronic
1130056413 15:80530159-80530181 GGAACCCATGTGATCATTGATGG - Intronic
1130940034 15:88499632-88499654 GCAACCCAAGTGTCTATTGATGG + Intergenic
1130979772 15:88804351-88804373 GTAAGCCAAGTGGCCAAGGATGG - Intronic
1131328425 15:91471071-91471093 GCAACCCAAGTGTTCATTGATGG + Intergenic
1132041777 15:98530946-98530968 GCAACTCAAGTGTCCATTGATGG + Intergenic
1132126963 15:99236035-99236057 GCAACCCAAGTGTTCCTTAATGG - Intronic
1134671242 16:16056703-16056725 TTAAACCAAGTGTTCAGGGAAGG - Intronic
1135050719 16:19190832-19190854 GCAATCCAAGTGTCCATTAAAGG - Intronic
1137480446 16:48848196-48848218 AGAAGCCCAGTGTTCCTTGAGGG + Intergenic
1137745622 16:50818142-50818164 ACATGCCAAGTGGTCATTGAGGG + Intergenic
1138849432 16:60608649-60608671 GTAAGCCAAATATTCCATGAGGG - Intergenic
1142721850 17:1781479-1781501 GTGAGGCAAATGTTAATTGAGGG + Intronic
1143278881 17:5735290-5735312 GCAGCCCAAGTGTCCATTGATGG + Intergenic
1145304386 17:21665257-21665279 GCAACCCAAGTGTCCATGGATGG - Intergenic
1146078934 17:29759815-29759837 GCAACCCAAGTGTCCATGGATGG - Intronic
1148291475 17:46454909-46454931 GTAAGCCATGCTTTCTTTGAAGG - Intergenic
1148313663 17:46672611-46672633 GTAAGCCATGCTTTCTTTGAAGG - Intronic
1150064868 17:62100571-62100593 CTAACCCAAGTGTTCAGGGATGG - Intergenic
1151240810 17:72756375-72756397 GCAACCCAAGTGTTTATGGATGG + Intronic
1153132150 18:1866532-1866554 GTAACTTAAGTGTCCATTGATGG + Intergenic
1153319822 18:3761479-3761501 GCAACCCAAGTGTTCATCTATGG - Intronic
1153463027 18:5358039-5358061 GCAATCCAAGTGTCCACTGATGG + Intergenic
1153497285 18:5712352-5712374 GTAGAGTAAGTGTTCATTGATGG - Intergenic
1153810229 18:8746136-8746158 GCAACCTAAGTGTTTATTGATGG - Intronic
1155260228 18:24034874-24034896 GCAACCCAAGTGTCCATTAATGG - Intronic
1156423699 18:36984997-36985019 GTAATCTAAATGTTCAATGAAGG + Intronic
1156730088 18:40183080-40183102 ACAACCCAAGTGTTCATAGATGG + Intergenic
1157388540 18:47281186-47281208 GCAATCCAAGTGTTCATCAATGG - Intergenic
1161763923 19:6196017-6196039 GCAACCCAAGTGTCTATTGATGG - Intronic
1161987795 19:7666863-7666885 GCAACCCAAGTGTCCATCGATGG + Intergenic
1162872204 19:13595142-13595164 GCAACCCAAGTGTTCATGGATGG + Intronic
1164122433 19:22278748-22278770 TTAATCCAAATTTTCATTGACGG - Intergenic
1166728970 19:45047116-45047138 GCAAGCTAAATGTCCATTGAGGG + Intronic
1168505396 19:56929656-56929678 GCAACCCAAGTGTCCATTCATGG + Intergenic
925500219 2:4495376-4495398 GCAACCCAAGTGTCCATTGAGGG - Intergenic
926354778 2:12031639-12031661 GCAACCCAAGTGTTCATCGGTGG - Intergenic
928053783 2:28029598-28029620 GCAACCCAAATGTTCACTGATGG - Intronic
928112369 2:28521172-28521194 GCAACCCAAGTGTCCACTGACGG - Intronic
928302617 2:30139797-30139819 GCAACCCAAATGTCCATTGATGG - Intergenic
928861917 2:35868698-35868720 ACAACCTAAGTGTTCATTGATGG + Intergenic
928978186 2:37110898-37110920 GCAACCTAAGTGTCCATTGATGG + Intronic
929092042 2:38228160-38228182 TTATTCCAATTGTTCATTGACGG - Intergenic
929345835 2:40883699-40883721 GCAACCCAAATGTCCATTGACGG + Intergenic
932749469 2:74362157-74362179 GGAAGACAAGGGTTCATTTATGG + Intronic
932825878 2:74939459-74939481 GGAAGCCAAATGTTCATAAAAGG + Intergenic
933447016 2:82393714-82393736 ACAACCCAAGTGTCCATTGATGG - Intergenic
933504163 2:83156547-83156569 GTAAGCCAAGTGTTGTTTTTTGG + Intergenic
935073059 2:99712828-99712850 CCAACCCAAGTGTCCATTGACGG + Intronic
935889934 2:107665651-107665673 CTAAGGCAAATGTTCTTTGATGG + Intergenic
936032847 2:109086174-109086196 GCAGCCCAAGTGTCCATTGATGG - Intergenic
936738826 2:115479147-115479169 GCAACCTAAGTGTCCATTGATGG + Intronic
937424120 2:121783671-121783693 GCAACCCAAGCGTCCATTGATGG + Intergenic
937737213 2:125306677-125306699 GTAAGACAAGTGTTCATCAATGG + Intergenic
938576853 2:132612409-132612431 GTAAGCAAAGAGTTCTTTGCAGG - Intronic
939276408 2:140003273-140003295 GAAAACCAATTATTCATTGAAGG + Intergenic
939577836 2:143917566-143917588 GTAGGCCAAGGGTTCATAGTGGG - Intergenic
940411870 2:153374010-153374032 GCAAGCCAAGTATACATCGATGG - Intergenic
940502503 2:154510972-154510994 GCAACCCAAGTGTTCATCAATGG - Intergenic
940927295 2:159379086-159379108 GCAACCCAAGTGTCCACTGATGG + Intronic
940963583 2:159813060-159813082 GCAACCCAAGTGTCCATGGATGG - Intronic
941291934 2:163686888-163686910 GGAGGCCAAGTGTGCTTTGAAGG + Intronic
941385912 2:164851754-164851776 ATAACCAAAGTGTCCATTGATGG - Intergenic
943610001 2:190021027-190021049 GTAACTCAAGTGTTCATTGATGG - Intronic
943727757 2:191269396-191269418 GTAACCCAAGTGTCCATCAATGG - Intronic
946176654 2:217926417-217926439 GCAACCCAAGTGTCCATGGATGG - Intronic
948400025 2:237677434-237677456 GCAACCCAAGTGTCCACTGATGG - Intronic
1169107356 20:3008210-3008232 GCACTCCAAGTGTCCATTGACGG + Intronic
1169370354 20:5024212-5024234 GCAACCCAAGTGTCCATCGATGG - Intergenic
1169764013 20:9129069-9129091 GCAACCCAAGTGTCCATTGATGG - Intronic
1169918214 20:10705183-10705205 AAAACCCAAGTGTTCACTGATGG - Intergenic
1172059695 20:32178212-32178234 GCAACCCAAATGTCCATTGATGG - Intergenic
1174995720 20:55566291-55566313 GCAACCCAAATGTCCATTGATGG - Intergenic
1175585549 20:60136594-60136616 ATAAGCCTAGTGTTCACTGTGGG + Intergenic
1177490603 21:21820952-21820974 GAAAGCAAAGTGTTCATCAACGG + Intergenic
1177715167 21:24831097-24831119 ACAACCTAAGTGTTCATTGATGG - Intergenic
1177717204 21:24854333-24854355 GTAAACCAAATGTACCTTGATGG - Intergenic
1177931960 21:27296371-27296393 GCAAGCCAACTGTTAAATGATGG - Intergenic
1178054025 21:28779204-28779226 GTAAACTAAGTGTTCATCAATGG + Intergenic
1178260003 21:31089932-31089954 GCAACCCAAATGTCCATTGATGG - Intergenic
1178470656 21:32889615-32889637 ACAACCCAAGGGTTCATTGATGG + Intergenic
1179020611 21:37637302-37637324 GAAACACAACTGTTCATTGAAGG - Intronic
1181115373 22:20629632-20629654 GTGAACAAAGTGTCCATTGAGGG - Intergenic
1181867114 22:25867526-25867548 GCAACCCAAATGTCCATTGATGG - Intronic
1183054359 22:35294040-35294062 GTAAGGCAAATGGTCAGTGATGG - Exonic
1183118502 22:35711282-35711304 ACAAGCCAACTGTCCATTGATGG - Intergenic
1183799159 22:40147038-40147060 GTGATCCAAGTGTCCATGGAAGG + Intronic
1184482323 22:44755070-44755092 GGCAGCCAAGTGTGCAGTGAGGG - Intronic
949700895 3:6756575-6756597 GCAATCTAAGTGTTCATTAAAGG + Intergenic
951427113 3:22560179-22560201 GTAACCCACGTGTCCATTAATGG + Intergenic
951760018 3:26137508-26137530 GTACCCCAAGTGTTCCTTGAGGG - Intergenic
953206680 3:40837392-40837414 GCAACCTAAGTGTTCACTGATGG + Intergenic
954340633 3:49950939-49950961 GCAACCCAACTATTCATTGATGG + Intronic
955663764 3:61328562-61328584 GAAACCCAAGTGTCCATTGATGG + Intergenic
956839424 3:73123676-73123698 GTAAGCCATGTGATCAATGGAGG + Intergenic
957279825 3:78136264-78136286 GCAACCCATGTGTTCATTGATGG - Intergenic
957530595 3:81436338-81436360 GTAAGCCATTTGTTCCTTGTTGG - Intergenic
958010780 3:87876348-87876370 GTAACCTAAATGTCCATTGATGG + Intergenic
959865524 3:111265314-111265336 GCAAACCAAGTGTACACTGATGG + Intronic
959987229 3:112587792-112587814 GCAACCCAGGTGTCCATTGATGG - Intergenic
960253298 3:115481835-115481857 ATAATCCAAGTGAGCATTGATGG + Intergenic
960344471 3:116515414-116515436 CTACCCCAAGTGTTCATTAAGGG - Intronic
961589715 3:127968580-127968602 GTAAGCCAACTTTTCATTTCTGG - Intronic
961769440 3:129238072-129238094 GCAACACAAGTGTCCATTGAAGG - Intergenic
962128888 3:132651597-132651619 GTAGGTCAAGTATTGATTGAAGG - Intronic
962147708 3:132857756-132857778 GGAGCACAAGTGTTCATTGATGG + Intergenic
962147772 3:132858507-132858529 GGAGCACAAGTGTTCATTGATGG - Intergenic
962887787 3:139643455-139643477 GGAAACCAAGTGTCCATTAACGG + Intronic
963822679 3:149915590-149915612 GCAACCCAAGTGTACATTGATGG + Intronic
963985999 3:151595363-151595385 GCAACCTAAGTGTCCATTGATGG + Intergenic
964323666 3:155524069-155524091 GTAACCCAAGCATCCATTGATGG + Intronic
964905660 3:161717060-161717082 GCAACTCAAGTATTCATTGATGG - Intergenic
965798220 3:172463828-172463850 GCAGCCCAAGTGTTCATTGATGG - Intergenic
966404068 3:179577400-179577422 GTAAGCCATATGTTCAGAGATGG - Intronic
966458390 3:180144607-180144629 GCAACCCAAGTGTCCATCGATGG - Intergenic
966963719 3:184968281-184968303 GTGGCCCAAGTGTCCATTGAAGG - Intronic
966987748 3:185197693-185197715 GCAACCCAAGTATCCATTGAAGG - Intronic
967019903 3:185513669-185513691 GCAACCCAAGTGTTCATTGATGG + Intronic
967748732 3:193089005-193089027 ATAACCCAAGTGTCCATTGGTGG - Intergenic
969377740 4:6774049-6774071 GCAACCGAAGTGTCCATTGACGG + Intergenic
971362186 4:25948400-25948422 GTAACCCAAGGGTTCATCAATGG - Intergenic
972429352 4:38965366-38965388 GTAAGCTAAGTGTCAATTGCAGG - Intergenic
973031995 4:45356677-45356699 GTAATCCAAGAGTTAATTAATGG - Intergenic
975658663 4:76666816-76666838 GCAACCCAAGTGTCCATGGAGGG + Intronic
976034842 4:80804522-80804544 GAAACTCAAGTGTCCATTGAAGG - Intronic
976798924 4:88965955-88965977 ATAATCCAAGTGTCCATGGATGG - Intronic
976927501 4:90517663-90517685 TTAAGCTAAGAGTGCATTGAGGG + Intronic
977210930 4:94216827-94216849 GCAATCCAAGTGCCCATTGATGG - Intronic
977826535 4:101539089-101539111 TTAATCCAATTGTTGATTGATGG - Intronic
979143712 4:117213068-117213090 GCAACCCAAGTGTTCATTGATGG - Intergenic
979655578 4:123189507-123189529 TTAAGACCAGTGTACATTGAGGG - Intronic
979718280 4:123868083-123868105 GCAACCCAAGTGTCCATTGAAGG + Intergenic
980225123 4:129973668-129973690 GTAATCCAAATGTTCATGAATGG + Intergenic
980475106 4:133304187-133304209 ATAAACTAAGTGTTCATTGATGG - Intergenic
981881291 4:149616190-149616212 GCAACCCAAGTGTCCATTGATGG + Intergenic
982273135 4:153611948-153611970 AAATGCCAAGTGTCCATTGACGG - Intronic
983303966 4:165962651-165962673 GTAAGCCAGGTGCTCATCAATGG + Intronic
985298686 4:188463597-188463619 GTAAGCCAAGTGTTCATTGCTGG + Intergenic
988481025 5:31630714-31630736 GGAGGCCATGTCTTCATTGAAGG + Intergenic
988716533 5:33834547-33834569 GCAAGCTAAGAGTTCATAGAGGG - Intronic
991398926 5:66233947-66233969 GGAAGCCAAGTGTGTATTGGAGG + Intergenic
991541614 5:67736104-67736126 GCAACCCAAGTGTCCATTGGTGG + Intergenic
991716551 5:69455954-69455976 GTAACCCAAGTGTCCATCGGTGG - Intergenic
993489887 5:88534170-88534192 GCAACTCAAGTGTCCATTGATGG + Intergenic
995307900 5:110676167-110676189 TTAATCTAAGTGTCCATTGATGG - Intronic
996676725 5:126183816-126183838 GGAAGCCAAATGTACATGGAGGG + Intergenic
997041110 5:130255772-130255794 CCAACCCAAGTGTTCATTAATGG - Intergenic
997810801 5:136966398-136966420 GTAACCCAAATGTTCATCAATGG - Intergenic
998165626 5:139841413-139841435 GTAAGCCAAGTGTTCATTGATGG - Intronic
999022428 5:148182730-148182752 AGAACCTAAGTGTTCATTGATGG - Intergenic
999038408 5:148379853-148379875 GTAACCCAAATGCCCATTGATGG + Intergenic
1000034987 5:157439628-157439650 GCAACCCAAGAGTTCACTGATGG + Intronic
1001408223 5:171491823-171491845 GTAACCCAAGCGTCCATTGATGG + Intergenic
1001472517 5:172024624-172024646 GCAACCCAAGTGTCCATTGATGG - Intergenic
1001525698 5:172427087-172427109 ACAACCCAAGTGTCCATTGATGG + Intronic
1003135181 6:3429646-3429668 GAAACTCAAGTGTTCACTGACGG + Intronic
1003336652 6:5179668-5179690 GTAACCCAAGTGTCCATGGATGG - Intronic
1003410450 6:5857257-5857279 GCAACCCAAGTGTTCATCAATGG - Intergenic
1003428548 6:6017371-6017393 GTATGACAAATGTCCATTGAAGG - Intergenic
1004020382 6:11771148-11771170 GTAAAGCAAGTTTTTATTGATGG - Intronic
1004129647 6:12907154-12907176 AAAAGCCAATTGTTCATTGAAGG - Intronic
1005267655 6:24129237-24129259 GTAACCCAAGAGTCCATTGAGGG + Intronic
1007226628 6:40320034-40320056 GTAAGCCAGGTGTCCCTGGAGGG - Intergenic
1008172818 6:48231001-48231023 GAAACCCCAGTGTTTATTGATGG - Intergenic
1008271090 6:49490910-49490932 CTATGCCCAGTGTTCTTTGATGG - Intronic
1008916185 6:56789848-56789870 GGAAGCTAAGTGTCCATTGATGG - Intronic
1009347585 6:62634928-62634950 GCAACCCAAATGTTCATTGAGGG + Intergenic
1009906772 6:69878796-69878818 GCAACCCAAATGTCCATTGATGG + Intronic
1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG + Intergenic
1010069270 6:71724404-71724426 GTAAAGCAAATTTTCATTGATGG + Intergenic
1010511473 6:76725786-76725808 GTAACCTAAATGTCCATTGATGG - Intergenic
1011277988 6:85647997-85648019 TTAACCCAAGTGTTCATTGATGG + Intergenic
1011754991 6:90489309-90489331 GCAAACCAAGTGTCCATTGATGG - Intergenic
1013614430 6:111828500-111828522 GCAACCCAAGTGTCCACTGATGG + Intronic
1014250512 6:119111116-119111138 GCAACCCAAGTGTCCCTTGATGG + Intronic
1014537344 6:122630271-122630293 GTAACTCAAGTGTCCATTGATGG + Intronic
1014634381 6:123826741-123826763 GCAACCCAAGAGTTCACTGATGG - Intronic
1015239011 6:131003490-131003512 GTAAGCCCAGTCTTCAATTAGGG + Intronic
1015848082 6:137542664-137542686 GCAACCCAAGTGTTCATTGTTGG + Intergenic
1016941185 6:149483922-149483944 GCAACCCAAGTGTCCACTGAAGG - Intronic
1017469884 6:154729079-154729101 GCAACCCAAATGTCCATTGATGG - Intergenic
1017605963 6:156133516-156133538 GAAAGCCAAATGTTCAAGGAGGG - Intergenic
1017886571 6:158604565-158604587 GTGTGCCAAGTGTGCACTGATGG - Intronic
1019965456 7:4495130-4495152 ACAACCCAAATGTTCATTGATGG + Intergenic
1021644043 7:22770501-22770523 GCAACCCAAGTGTCCACTGAGGG + Intergenic
1021952399 7:25788019-25788041 TTAAGCCAACCGTTGATTGAAGG - Intergenic
1023240638 7:38143022-38143044 CCAACCCAAGTGTTCATTGAAGG + Intergenic
1023963850 7:44950789-44950811 GCAAGCCAAGTGTCCATTGATGG - Intergenic
1024155270 7:46615760-46615782 ATAAACCAAATGTTCATCGATGG - Intergenic
1024317156 7:48031790-48031812 ACAACCCAAGTGTTTATTGATGG + Intergenic
1028953627 7:96664788-96664810 ACAAACCAAGTGTTCATTAATGG + Intronic
1030062060 7:105630148-105630170 ACAACCTAAGTGTTCATTGAGGG - Intronic
1030246047 7:107385449-107385471 GCAAACCAAGTGTCCATTGATGG + Intronic
1030314069 7:108096403-108096425 GTAACCCAAGTATCCACTGATGG - Intronic
1031318990 7:120297452-120297474 TCAACCTAAGTGTTCATTGATGG - Intronic
1031371227 7:120969234-120969256 GTAGACCAAGTGTTCAGTAAAGG - Intronic
1031415304 7:121488994-121489016 TTAATCCAGGTGTTCCTTGAAGG + Intergenic
1032334615 7:131013387-131013409 ATAAGCCACATGTGCATTGAAGG - Intergenic
1032813263 7:135444359-135444381 GTAATCCAAGTGTCCATCAATGG + Intronic
1033021867 7:137733489-137733511 ATAATCCAAGTATTCATTGATGG - Intronic
1033383355 7:140846241-140846263 GCAACCCAAGTGTCCACTGATGG + Intronic
1034209674 7:149352383-149352405 GTAGCCCAAGTGTTCATTGGAGG + Intergenic
1034249707 7:149678654-149678676 GCAACCCAACTGTCCATTGATGG - Intergenic
1034261157 7:149756630-149756652 GGCAACCAAGTGTTCATTGGTGG + Intergenic
1034687721 7:152987993-152988015 ACAACCTAAGTGTTCATTGATGG + Intergenic
1036431597 8:8696799-8696821 GCAACCCAAGGGTTCACTGATGG + Intergenic
1036654236 8:10665769-10665791 GCAACCCAAGTGTCCATTGATGG + Intronic
1037380450 8:18279781-18279803 GTTTGCCAAGTGTCCATTCACGG + Intergenic
1038283412 8:26185915-26185937 GCAATCCAAGTGTCCATTGATGG + Intergenic
1038884544 8:31648806-31648828 GTAAACCAGGTGTCCACTGATGG - Intronic
1039916921 8:41866854-41866876 GCAATCCAAGTGTCCATTGATGG - Intronic
1040420768 8:47238662-47238684 TTAAGCCAAGTGTGGAATGATGG - Intergenic
1040562347 8:48534902-48534924 ATAACCCAAGTGTTCATTGATGG + Intergenic
1041079739 8:54204837-54204859 GCAACACAAGTGTCCATTGATGG - Intergenic
1042078535 8:65023167-65023189 GAAACCTAAGTGTTTATTGATGG + Intergenic
1042944839 8:74144616-74144638 GTACGCCAAGCTTTTATTGAGGG + Intergenic
1043595897 8:81884392-81884414 GTAAGACAAGTATTAATTGTTGG + Intergenic
1045072445 8:98522941-98522963 GCAACCCAAGTGTCCATTGATGG - Intronic
1045970634 8:108076203-108076225 TTAAGCCAAGTGTGCTTTCAAGG + Intronic
1048010973 8:130455868-130455890 TGAACCCAAGTGTTCATTGACGG + Intergenic
1048326726 8:133445359-133445381 TTAACCTAAGTGTCCATTGATGG - Intergenic
1048396813 8:134021780-134021802 GCATCCCAAGTGTCCATTGATGG - Intergenic
1050062373 9:1723125-1723147 GCAAGGCATGTGGTCATTGACGG + Intergenic
1050464947 9:5912420-5912442 ATAATCCAAGTGTTCTTAGATGG - Intronic
1050602598 9:7267762-7267784 GGAAGCCAGGTGTTGAGTGATGG + Intergenic
1051357327 9:16251774-16251796 GCAACCCAAGTGTTCATAGATGG + Intronic
1051376038 9:16403962-16403984 GCAACCCAAGTGTCCATCGATGG + Intergenic
1051821372 9:21173173-21173195 GCAACCCAAGTGTCCATTGATGG + Intergenic
1051829659 9:21261442-21261464 GTAATCCAAGTGCTCATCAATGG + Intergenic
1052579545 9:30337500-30337522 ATAATCCAAGAGTCCATTGATGG - Intergenic
1053587320 9:39472772-39472794 GTAACCCAAGTGTCCATTAATGG - Intergenic
1054578982 9:66892466-66892488 GTAACCCAAGTGTCCATTAATGG + Intronic
1055362347 9:75506381-75506403 GCAACCCAAATGTTCATTGAGGG - Intergenic
1055526710 9:77141319-77141341 GTAAGGCAAGAGAACATTGAAGG + Intergenic
1055587031 9:77765824-77765846 GGAACCCAAGTGTCCATTGGTGG + Intronic
1056434798 9:86565439-86565461 GCAACCCAAGTGTTCATCAATGG - Intergenic
1057121223 9:92576095-92576117 GCAATCCAAGTGTTCATCAAAGG + Intronic
1058136475 9:101313332-101313354 AAAAGCTAAGTGTTCCTTGAGGG + Intronic
1059141836 9:111860574-111860596 ACAACCTAAGTGTTCATTGATGG - Intergenic
1060034022 9:120239773-120239795 GCAACTCAAGTGTTCATTGATGG + Intergenic
1061932820 9:133842056-133842078 AGAATCCAAATGTTCATTGAGGG - Intronic
1062685319 9:137809780-137809802 ATAAACCAAGTGTTCAGTAAAGG + Intronic
1186149460 X:6658796-6658818 TTAAGCCAAGTGTCCATGCATGG + Intergenic
1186703695 X:12119085-12119107 TTAGGCCAAGTGTTCATTCTTGG + Intergenic
1187144444 X:16625128-16625150 GCAACCCAAATGTTCACTGAGGG + Intronic
1189190303 X:39095879-39095901 GCAACCCAAGTGTCTATTGATGG + Intergenic
1189734952 X:44060404-44060426 GCAACCCAAGTGTTCATTAACGG - Intergenic
1190253021 X:48741870-48741892 GGAAGCCAGGTCTTCAGTGATGG + Intergenic
1190691182 X:52914765-52914787 ACAACCTAAGTGTTCATTGATGG - Intergenic
1190694801 X:52941027-52941049 ACAACCTAAGTGTTCATTGATGG + Intronic
1192115288 X:68404600-68404622 ACAACCCAAATGTTCATTGATGG + Intronic
1192507295 X:71696360-71696382 GCAACCCAAGTGTCCACTGATGG + Intergenic
1192512566 X:71732168-71732190 GCAACCCAAGTGTCCACTGATGG - Intergenic
1192514131 X:71749341-71749363 GCAACCCAAGTGTCCACTGATGG + Intergenic
1192519401 X:71785192-71785214 GCAACCCAAGTGTCCACTGATGG - Intergenic
1192526839 X:71853846-71853868 GCAACCCAAGTGTCCACTGATGG + Intergenic
1192538921 X:71951852-71951874 GAAAGCCAAGTCTACAGTGAGGG - Intergenic
1193101085 X:77612992-77613014 GCAACCCAAATGTCCATTGATGG - Intronic
1193848843 X:86510046-86510068 GGAAGACAAGCTTTCATTGAAGG + Intronic
1196222937 X:113133529-113133551 TTAACCCAAGTGTTCATTGTAGG + Intergenic
1196800151 X:119535507-119535529 GCAACCCAAATGTCCATTGACGG + Intergenic
1197021067 X:121689709-121689731 ATAACCTAAATGTTCATTGATGG - Intergenic
1197703904 X:129620117-129620139 CTAAGGCAACTGTTCATTCAAGG - Intergenic
1198212939 X:134531966-134531988 GCAAACCAAATGTCCATTGATGG - Intergenic
1198501232 X:137249290-137249312 GTAAGCAAAGTTTTCTTAGATGG + Intergenic
1198537037 X:137596868-137596890 GTAAGGAAAGGCTTCATTGAGGG + Intergenic
1200177713 X:154128744-154128766 TTAACCCAAGTGTCCATCGATGG + Intergenic
1200323782 X:155216670-155216692 CTGAGCCAAGTGTTCAGGGAGGG + Intronic
1200329088 X:155276195-155276217 TTAAACCAAGAGTTAATTGAAGG + Exonic
1200703029 Y:6418354-6418376 GTATACCAAGTGTCCCTTGAAGG + Intergenic
1200907367 Y:8497856-8497878 GTCAGCTAGGTGTGCATTGAAGG - Intergenic
1201031081 Y:9746343-9746365 GTATACCAAGTGTCCCTTGAAGG - Intergenic
1202051579 Y:20786674-20786696 GCAACCTAAGTGTTCATTGCGGG - Intergenic