ID: 998167111

View in Genome Browser
Species Human (GRCh38)
Location 5:139850513-139850535
Sequence AGCCAGGCCTGCCCAGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 1, 2: 6, 3: 79, 4: 393}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998167102_998167111 17 Left 998167102 5:139850473-139850495 CCTCAGGAGCAGGAACCTGGCAG 0: 1
1: 1
2: 1
3: 26
4: 451
Right 998167111 5:139850513-139850535 AGCCAGGCCTGCCCAGCACAGGG 0: 1
1: 1
2: 6
3: 79
4: 393
998167106_998167111 -7 Left 998167106 5:139850497-139850519 CCACTTCTGGATTCCCAGCCAGG 0: 1
1: 0
2: 3
3: 30
4: 281
Right 998167111 5:139850513-139850535 AGCCAGGCCTGCCCAGCACAGGG 0: 1
1: 1
2: 6
3: 79
4: 393
998167105_998167111 2 Left 998167105 5:139850488-139850510 CCTGGCAGGCCACTTCTGGATTC 0: 1
1: 1
2: 6
3: 39
4: 240
Right 998167111 5:139850513-139850535 AGCCAGGCCTGCCCAGCACAGGG 0: 1
1: 1
2: 6
3: 79
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998167111 Original CRISPR AGCCAGGCCTGCCCAGCACA GGG Intronic
900498968 1:2990373-2990395 AGCCAGGCATGCAGAGCACGTGG - Intergenic
901443139 1:9291835-9291857 ACTCAGGCCCGCCCAGCCCAGGG + Intergenic
901902290 1:12375648-12375670 GGGCAGGGCTGCCCAGTACATGG - Intronic
902399440 1:16150097-16150119 AGCCAAGCCTGCCCAGAGCTAGG + Intronic
903290858 1:22313420-22313442 AGCTACTCTTGCCCAGCACAGGG - Intergenic
903832886 1:26185051-26185073 AGTCCGGCCGGCCCAGCTCACGG - Exonic
904465359 1:30704455-30704477 ACCCAGGCCAGCCCAGGACAGGG + Intergenic
904595171 1:31639630-31639652 TGCCCTGCCTGCCCAGCACCTGG - Intronic
904924815 1:34039197-34039219 GGCCAGGCCTGACCTCCACAGGG - Intronic
905178031 1:36150239-36150261 AGCCACGCATGCCCAGCACTTGG + Intronic
905386270 1:37606325-37606347 AGCCAGGCCTGTCCATAAAATGG - Intergenic
905397744 1:37677892-37677914 ACCCAGCCCTGCACAGGACATGG - Intergenic
905480360 1:38257707-38257729 AGCCATGGCTGCCAGGCACATGG - Intergenic
905517432 1:38572134-38572156 AGCCAGGGGTGACCAGCACAGGG - Intergenic
905866734 1:41380949-41380971 GGCCAGGCCCTCCCAGCAAAGGG + Intronic
906078741 1:43069922-43069944 GGCCTGGCCTGCCCAGCTCCAGG - Intergenic
907273523 1:53304481-53304503 AGCTTGGCCTTCCCAGAACATGG - Intronic
907384109 1:54114776-54114798 AGCTAGGCATGCCCAGCACAGGG - Intergenic
907453105 1:54559884-54559906 AGCCAGGTCAGCCCAGGACAAGG - Intronic
908000524 1:59674024-59674046 AGGCATGCCTGCGCAGGACAAGG - Exonic
908157202 1:61365881-61365903 AGCCAGGCTTACCCAGCTGAGGG + Intronic
912300302 1:108509179-108509201 AGCCAGGCGAGCCCATCTCATGG - Intergenic
912547066 1:110458408-110458430 AGCCAGGCCAGGCCCCCACAGGG + Intergenic
913529158 1:119721241-119721263 TGCCAGCCCTGCCCACCACCTGG - Exonic
914438602 1:147681708-147681730 TTCCAGGCCTGCCCAGGATAAGG + Intergenic
915145404 1:153793643-153793665 AGCCACCCCTGTCCAGGACATGG + Intergenic
915601415 1:156925035-156925057 AGCCAGGCTTCCCAGGCACAGGG - Intronic
915676298 1:157535262-157535284 AGCCATGCCTGGCCTGCCCAAGG + Intronic
916743249 1:167664255-167664277 AGCCACTCCTGTCCAGCCCAGGG - Intronic
917795822 1:178532085-178532107 AGCCAGGCCTGTCATGGACAGGG + Intronic
918132586 1:181642784-181642806 AGCCTGGATGGCCCAGCACAGGG + Intronic
920630369 1:207645819-207645841 GCCCAGGCCAGCCCAGCCCATGG - Intronic
920674460 1:208029538-208029560 AGCCAGGCCAGGCCAGCCCTGGG - Intronic
921372884 1:214443620-214443642 AACCAGCCCTTCCCAGGACAAGG - Intronic
922883205 1:228998266-228998288 ACGCAGGTCGGCCCAGCACATGG - Intergenic
924446624 1:244138656-244138678 AGCCAGGCCCGGGCAGCCCACGG - Intergenic
1062847761 10:720862-720884 GGCCAGGCCTCCAGAGCACAGGG + Intergenic
1063161765 10:3423648-3423670 AGCCACGCCTGGCCAGGACACGG - Intergenic
1063448692 10:6136650-6136672 AGCCAGCCGTGGCAAGCACACGG - Intergenic
1064030536 10:11880163-11880185 AGCCAGGCCTGCCCAGCCTCGGG - Intergenic
1064418387 10:15169097-15169119 ACCCTGGCCAGCCCTGCACAGGG + Intergenic
1064911528 10:20406896-20406918 GGCCAAGTCTGCCAAGCACATGG + Intergenic
1065189244 10:23195235-23195257 GGCCAGGCCTGCGCCGCACGGGG - Intergenic
1070282993 10:75063440-75063462 CTGCAGGCCTGACCAGCACAAGG - Intergenic
1070804909 10:79265255-79265277 GGCAGGACCTGCCCAGCACAGGG + Intronic
1070963008 10:80512079-80512101 GGCCATGGCTGCCCAGCATAGGG - Intronic
1072680107 10:97499648-97499670 AGCCAGGCGTCCCCAGAACTCGG + Intronic
1072699148 10:97627502-97627524 AGCTAGGCCTGACCAGAGCAGGG + Intronic
1076171990 10:128327096-128327118 AGCCCACCCAGCCCAGCACAGGG - Intergenic
1076358706 10:129871178-129871200 CGCGAGCCCTGCCCAGCACCCGG - Intronic
1076576342 10:131472299-131472321 AGCCAGGCCTTCCCAGATCTAGG - Intergenic
1076630282 10:131848307-131848329 ACCCAGGCCTGCCCAGCCACTGG + Intergenic
1076804798 10:132849962-132849984 AGCCAGCCCGCCCCAGCACGCGG - Intronic
1076868717 10:133182281-133182303 GGCCAGGGCAGCCCAGGACACGG + Intronic
1077046733 11:550012-550034 GCCCAGGCCTCCCCAGCCCAGGG - Intronic
1077158036 11:1100073-1100095 GGACAGTCCTGCCCGGCACAAGG - Intergenic
1077225863 11:1438903-1438925 AGCCAGGCATGCCTGGGACAGGG - Intronic
1077287374 11:1773541-1773563 ACCCAGGCCTGTCCAGCCCTGGG - Intergenic
1077443029 11:2577552-2577574 GGCCAGGCCTCCCCGTCACATGG - Intronic
1077465923 11:2733634-2733656 AGCCAGGCCTGGGCAGCCCTGGG + Intronic
1077635796 11:3840827-3840849 AGCCCGGCCGGCCCAGGACTCGG - Intronic
1078760214 11:14245592-14245614 GGCCAGTCCTGACCAGCACAAGG - Intronic
1079332742 11:19547109-19547131 AGCCTCTCCTGCCCTGCACATGG + Intronic
1081821250 11:45997779-45997801 AGGCAGGTCTGCCCAGCAGCAGG - Intronic
1082691420 11:56308746-56308768 ACACAGGCCTGCCGAGCACTGGG - Intergenic
1082842209 11:57698945-57698967 AGCCAGGCTGGCCCAGCAACGGG + Exonic
1083153947 11:60811022-60811044 CACCAGGCCTTCCCAGGACACGG + Intergenic
1083311279 11:61785036-61785058 AGCTAGGCCCACCCAGCACAGGG - Intronic
1083614018 11:64017726-64017748 TGCCAGGACTGCCCAGGCCAAGG - Intronic
1083682551 11:64358183-64358205 AGCCAGGGCTTCACAGGACAGGG + Intergenic
1083697401 11:64452026-64452048 AGCCTGCCCTGCCCAGCCTATGG + Intergenic
1083933854 11:65860355-65860377 AGCCAGTCCTCCCCGTCACAGGG + Intronic
1083989330 11:66237203-66237225 AGCCGGGCATGCCGTGCACAGGG - Intronic
1084009871 11:66341451-66341473 AACCACGCCTGCCCAGTACCAGG + Intronic
1084430690 11:69109288-69109310 AGCCAGGCCTGCCCTGGCCCAGG - Intergenic
1084527623 11:69706493-69706515 AGCCAAGCCTGCAGAGGACAAGG + Intergenic
1087192666 11:95271874-95271896 ATCCAGGTCTACACAGCACAAGG - Intergenic
1088832231 11:113547292-113547314 TTCCAGGCGTGCCCACCACAGGG + Intergenic
1088881495 11:113976756-113976778 AGCCAGGCCTTGCCAGCACCTGG + Intronic
1089200812 11:116723801-116723823 AGCCCTGCCTGCCCACCACAAGG + Intergenic
1089387355 11:118077142-118077164 ACCAAGGCCTGCCCTGCACTCGG + Exonic
1089573226 11:119423364-119423386 GGCCAGGCCTGCCAGCCACAGGG - Exonic
1090077480 11:123588337-123588359 ACCCAGCCCTGCCCAGCCCTTGG + Intronic
1090642819 11:128743905-128743927 AGCCTGGACAGTCCAGCACAGGG - Intronic
1091206878 11:133827725-133827747 AGCCAGACCTGCCAAACTCAAGG + Intergenic
1091267579 11:134282730-134282752 AGGAAGCCCTGCCCACCACAGGG - Intronic
1091601556 12:1921124-1921146 AACCAGGCCTTCTCAGCCCAAGG + Intergenic
1091704422 12:2684105-2684127 AGCCAGGCCAGCACAGCATGCGG + Intronic
1091710996 12:2740455-2740477 AGCCAGGCCAGCACAGCATGCGG + Intergenic
1092140596 12:6180710-6180732 AGCCAGGCCTGCCCCGCAGTGGG - Intergenic
1092160373 12:6312355-6312377 AGCCTGGACTCACCAGCACAGGG - Exonic
1092728375 12:11506247-11506269 AGCCAGGCCAGCACAGCATGTGG - Intergenic
1093055008 12:14547300-14547322 AGCCAGTCCTGCCACACACAGGG + Intronic
1094237809 12:28188663-28188685 AGCCAGATCTGCCCAACAGAAGG - Intronic
1095782632 12:46077212-46077234 AGTCAGGCCTTCACATCACATGG + Intergenic
1095955902 12:47805799-47805821 GGCCAGGCCAGACCAGTACAGGG + Intronic
1096253631 12:50050048-50050070 ACACAGGGCTGCCCAGCCCAAGG + Intergenic
1096361252 12:50989343-50989365 AGCCAGGCATGGTTAGCACATGG + Intronic
1096459512 12:51814501-51814523 AGCCAGGCGGTCCCAGGACAGGG + Intergenic
1096577927 12:52566153-52566175 AGTCAGGCCTGGCCGACACAAGG - Exonic
1098220136 12:68261119-68261141 AGCGAGGTCTGCCCAGGAAATGG + Intergenic
1102509028 12:113401977-113401999 AGCTAGGAGTGCCCAGGACAGGG - Intronic
1102571568 12:113830125-113830147 AGCAAAGCCTGCCCCGCAGAGGG + Intronic
1104507855 12:129349632-129349654 AGTAAGGCCTGTTCAGCACACGG + Intronic
1104950485 12:132437687-132437709 GGCCAGGCCTGCCCAACACAGGG + Intergenic
1106109496 13:26763956-26763978 AGCCAGTACTGCACAGCACATGG + Intergenic
1106252619 13:27994214-27994236 ACCCATGCCTGCCCAGCTCCTGG - Intergenic
1107898337 13:44988218-44988240 AGACAGGCCTGTCCAACACGGGG + Intronic
1107994604 13:45847975-45847997 AGGCAGGGCTGCCCAGGGCAGGG + Intronic
1109379078 13:61535058-61535080 AGCCAGGCAAACCCAGCAGACGG + Intergenic
1109741511 13:66561130-66561152 TGCGGGGCCTGCCCAGCACACGG - Intronic
1110711177 13:78652818-78652840 AACCAGGACTGCACAGCAGAAGG - Intronic
1111485585 13:88895358-88895380 AGCCAGGGCTGCCCACTCCATGG + Intergenic
1113769046 13:112897013-112897035 GGCCAGGCCGGCAGAGCACAGGG + Intronic
1114635329 14:24183952-24183974 GGCCAGGCCTGCCCTGCAATGGG - Intronic
1115918451 14:38343388-38343410 ACCCAAGCCTGCACAGCACTGGG - Intergenic
1116520338 14:45839216-45839238 AGCCAGGCCTGTCCATCACCAGG + Intergenic
1118113608 14:62750127-62750149 AGTAAGGCCTGTTCAGCACAGGG - Intronic
1118309562 14:64682413-64682435 GGCCAGCCCTGCCCTGCCCACGG - Intergenic
1119443946 14:74648189-74648211 AGCCAGCCCTCTCCAGCACCAGG + Intergenic
1119483022 14:74971060-74971082 AGCCAGGCCTTCCCAGCTCAGGG + Intergenic
1120849626 14:89158194-89158216 CGCCAGGACTGCCCAGGCCAAGG - Exonic
1120867151 14:89305116-89305138 AGGAAGGCCTGGCCAGCACCAGG + Intronic
1121261403 14:92568935-92568957 GGCCAGGCATCCCCACCACATGG - Intronic
1121313442 14:92947298-92947320 AGGGTGGCCTGACCAGCACATGG - Intronic
1121314285 14:92951917-92951939 GGCCAGGCCATCCCAGCAGAGGG + Intronic
1121334594 14:93069601-93069623 AGACAGGCCTGCCCTGCCCCTGG + Intronic
1122691263 14:103533111-103533133 GGCCGGGCCTGCCCTGCACTTGG - Intronic
1122829510 14:104388924-104388946 CGCCAGCCCCTCCCAGCACATGG - Intergenic
1122837429 14:104437021-104437043 GGCCAGGCCAGCACAGCACGGGG + Intergenic
1122913575 14:104845444-104845466 AGCCAGGCCTGGCCAGCCCCTGG + Intergenic
1122939119 14:104973421-104973443 AGCCAGGCCTGCCAAGCAGCAGG + Intronic
1122976294 14:105172225-105172247 AGCCTGGGCCGCCCAGCACCAGG - Intergenic
1123008040 14:105333800-105333822 TGGCAGGGCTGCCCAGGACAGGG + Intronic
1202848490 14_GL000225v1_random:1253-1275 AGCCAGGCCGCGCCAGCAGAGGG + Intergenic
1202864254 14_GL000225v1_random:104893-104915 AGCCAGGCCGCGCCAGCAGAGGG - Intergenic
1124600592 15:31129986-31130008 GACCAGCCCTGCCCAGGACATGG - Intronic
1125578560 15:40770595-40770617 AGCCAGGCCAGCACAGCAGGTGG + Exonic
1125677739 15:41511697-41511719 GGCCAGCCCAGCCCAGCGCAGGG + Intronic
1125729660 15:41886043-41886065 CTCCAGCCCTGCCCAGCACTGGG + Exonic
1128144684 15:65326388-65326410 AGCCCTGCCTGGCCAGCACCTGG + Intergenic
1128647771 15:69389601-69389623 AGCCAGGCCTTGGCACCACATGG - Intronic
1128720002 15:69941324-69941346 GGCCTGCCCTGCGCAGCACATGG + Intergenic
1129387704 15:75204953-75204975 AGTCAGGGCAGCCCAGCAGATGG - Intronic
1129709940 15:77815721-77815743 ACCCAGGTCTTCCCAGCACCTGG + Intronic
1129868528 15:78926385-78926407 ACAGAGGCCAGCCCAGCACAGGG + Intronic
1130321691 15:82847784-82847806 AGCCTGGTCTGCCCAGCAGCAGG - Intronic
1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG + Intronic
1131883309 15:96881748-96881770 AGCCAGGCATTCTCAGCACCTGG + Intergenic
1132023169 15:98382370-98382392 AGAAGGGCCTGCTCAGCACACGG + Intergenic
1132349749 15:101132485-101132507 AGCCAGGCCTCCAGAGCCCACGG - Intergenic
1132481148 16:166710-166732 ACCAAGGCCTGCGCAGCACAGGG - Exonic
1132574522 16:658381-658403 GGCCAGGCCTGGACAGCACAGGG - Intronic
1132579226 16:677525-677547 GGCCAGGTGTGCCGAGCACAGGG - Exonic
1132658211 16:1050037-1050059 TGACAGGCCTGCCCAGCGCCGGG + Intergenic
1133003662 16:2865192-2865214 ATCCATGCCTGCCCTGCCCAGGG + Intergenic
1133667342 16:7981807-7981829 ATCCAGGGCTGCTCATCACACGG + Intergenic
1134062232 16:11206137-11206159 GGCCAGGCCAGGCCAGCTCAGGG - Intergenic
1134444361 16:14319717-14319739 AGCCAGGCCTGCCCCTCTCAGGG - Intergenic
1137935084 16:52627308-52627330 AGATAAGCCTGCACAGCACAGGG + Intergenic
1138604696 16:58081340-58081362 TGCCAGGCCTTCCAAGCCCAGGG - Intergenic
1141111871 16:81276465-81276487 AGCCAGCCCTGGCCACCTCATGG - Intronic
1141462188 16:84184162-84184184 TCCCAGGCCAGCCCAGCAAAGGG - Intronic
1141525330 16:84607331-84607353 AGGCAGGCCAGCGCGGCACAGGG + Intronic
1142221109 16:88855753-88855775 AGCCACGACTGCCCAGCCCTTGG + Intronic
1142418199 16:89954452-89954474 AGCCAGGGCTGCGCAGGACGCGG - Intronic
1142610844 17:1108707-1108729 CTCCAGGCCAGCCCAGCTCAGGG - Intronic
1146054247 17:29573359-29573381 AGACAGACGTTCCCAGCACAGGG + Intergenic
1146568432 17:33933126-33933148 AGCCAGCCATGCCCATCACAGGG + Intronic
1147000521 17:37359107-37359129 CACCAGGCCGGCCCGGCACACGG + Exonic
1148049027 17:44760060-44760082 CACCAGGCCTGCCCAGCCCCAGG + Intronic
1148145692 17:45363323-45363345 AGCTAGTGGTGCCCAGCACAAGG - Intergenic
1148327158 17:46789986-46790008 AGACAGCCCTGCCCAGCACCTGG + Intronic
1149298881 17:55286012-55286034 AGCCAGGACTGCCTGGGACAGGG + Intronic
1149492393 17:57094501-57094523 CGCCAGGCCAGGCCAGCAGAAGG + Intronic
1150057313 17:62030248-62030270 AGCCAGGCAGGGCCAGCACACGG + Intronic
1150917526 17:69451743-69451765 ATCCAGTCATGCTCAGCACAGGG - Intronic
1151561297 17:74871272-74871294 GGCCTGGACTGCCCAGGACAAGG - Intronic
1152101066 17:78301989-78302011 GGCCTGGCCTGCCCTGCACCGGG + Intergenic
1152124468 17:78438032-78438054 ATCCTGGCATGCCCAGCACCTGG - Intronic
1152466480 17:80469595-80469617 AGCCAGGCCTGGCCAGGGCAGGG - Exonic
1152566580 17:81103095-81103117 AGCCAGGCCTGACCCCCACTGGG + Intronic
1152570901 17:81120843-81120865 AGCTGGGCCTGCCGAGCACTGGG - Exonic
1152808565 17:82370772-82370794 AGCCTCGCCTCCCCAGCACGTGG + Intergenic
1152994658 18:395398-395420 GGCCAGGCATACTCAGCACAGGG + Intronic
1153746498 18:8185303-8185325 AGTGTGGCCTGCACAGCACAGGG - Intronic
1153882667 18:9434539-9434561 AGCCAGGCCTGCACGGCGGAGGG + Intergenic
1154201943 18:12306302-12306324 ACCAAGGCCTCCCCAGGACATGG - Intergenic
1155155936 18:23157438-23157460 AGCCAGCCCTTCCCACCTCAAGG - Intronic
1156473240 18:37390477-37390499 AGCCCTGCATGCCCAGCAGAGGG - Intronic
1157224925 18:45854033-45854055 GGCCAGGCCTGGGCAGCCCAGGG + Intronic
1157282262 18:46353853-46353875 AGCCAGGCCACCCCACCACAAGG - Intronic
1160012883 18:75119884-75119906 AGCCAGCCCTCCCCAACACGGGG - Intergenic
1160662694 19:308466-308488 GGCGAGGCTGGCCCAGCACAGGG + Intronic
1160889258 19:1368692-1368714 AGCCAGGCTAGGCCAGCACCTGG - Intronic
1161444610 19:4311159-4311181 AGAAGGGCCTGCCCACCACATGG + Intronic
1161614762 19:5263906-5263928 AGGCAGGCCAGGCCGGCACAGGG + Intronic
1163460294 19:17433398-17433420 AGGCAGGTCTGCCCAGCTCCCGG + Intronic
1163702997 19:18795830-18795852 AGCCCGGCCCGCCCAGGGCAGGG - Intergenic
1163792457 19:19315640-19315662 AGAAAGGCCTGCCCAGCAGAGGG - Intronic
1164783907 19:30914300-30914322 GGCCAGGCCTGCAGAGGACAGGG - Intergenic
1164813397 19:31175827-31175849 AGCCAGGCCTGCAGTGCTCAGGG - Intergenic
1164902955 19:31943590-31943612 ATCCAGGCCAGCCCGGCAGAGGG + Intergenic
1165782682 19:38443071-38443093 AGCCGCCCCTCCCCAGCACAAGG - Intronic
1166670045 19:44704184-44704206 TGCCATGCCTGGCCAGCACCCGG - Exonic
1166693061 19:44835725-44835747 AGCCATGCCTGGCCAGCCCCTGG + Intergenic
1167239822 19:48337114-48337136 AGCCAGGCCTGCCAGCTACAGGG - Intronic
1167356238 19:49006016-49006038 CCCCAGTGCTGCCCAGCACAGGG - Intronic
1167359213 19:49020928-49020950 TACCAGGCCTGCCCACCTCAGGG + Intergenic
1167366908 19:49059175-49059197 TGCCAGGCCTGCCCACCTCGGGG + Intronic
1168651183 19:58093260-58093282 AGCCAGCTCTGCCCAGGCCAAGG - Intronic
925059491 2:880225-880247 AGCCGAGCCTGCCCGGGACAGGG - Intergenic
925111528 2:1342365-1342387 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111547 2:1342478-1342500 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111568 2:1342592-1342614 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111588 2:1342706-1342728 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111607 2:1342820-1342842 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111627 2:1342934-1342956 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111647 2:1343048-1343070 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111667 2:1343162-1343184 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111686 2:1343275-1343297 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111707 2:1343389-1343411 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111727 2:1343503-1343525 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111746 2:1343616-1343638 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111765 2:1343729-1343751 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111783 2:1343842-1343864 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111802 2:1343955-1343977 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111822 2:1344069-1344091 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111841 2:1344182-1344204 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111860 2:1344295-1344317 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111879 2:1344408-1344430 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111897 2:1344521-1344543 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111916 2:1344634-1344656 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111936 2:1344748-1344770 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111955 2:1344861-1344883 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111975 2:1344975-1344997 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925111993 2:1345088-1345110 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925112013 2:1345202-1345224 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925112033 2:1345315-1345337 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925112052 2:1345429-1345451 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925112073 2:1345543-1345565 GGCCAGGCGTGCCCACAACAGGG - Intronic
925112093 2:1345656-1345678 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925112114 2:1345769-1345791 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925112134 2:1345882-1345904 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925112154 2:1345996-1346018 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925112175 2:1346110-1346132 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925112196 2:1346224-1346246 GGCCAGGCGTGCCCAGAACAGGG - Intronic
925244392 2:2367427-2367449 AGCCAGGCCCGCCCCACAGATGG - Intergenic
925577092 2:5371143-5371165 AGCCAGTCCATCCCAGCCCAGGG + Intergenic
925947313 2:8877835-8877857 TGCCAGCCGTGCCCAGCTCAGGG - Intronic
926116612 2:10217600-10217622 ACCCAGGCCTGGGCACCACATGG - Intergenic
931190492 2:59995608-59995630 AGCCAGGTCTGCACAGAGCAGGG - Intergenic
931690764 2:64832867-64832889 AGCCAGGCTTGGCCACCACCAGG + Intergenic
932216327 2:69968711-69968733 AGCCTGGTCTGCCCAGCTCTTGG + Intergenic
933181790 2:79235580-79235602 TGACAGGCCTGCCCTGCAGAAGG + Intronic
933707918 2:85305304-85305326 ACCCTGGCCTGCCCACCTCAGGG + Exonic
934048445 2:88190680-88190702 ATCCAACACTGCCCAGCACATGG - Intergenic
934551982 2:95268309-95268331 AGCCTGCCCTGCTCAGCACCTGG - Intergenic
934710487 2:96511072-96511094 AGCCAGCACTGCCTAGCCCAGGG + Intergenic
934954725 2:98608251-98608273 AGCCAGGCCTGCCTGGGACAGGG + Intronic
935354538 2:102186961-102186983 AGGCAGGTCTGCCCCGCCCACGG + Exonic
935448147 2:103178557-103178579 AGCCAGCTCTGCATAGCACAAGG + Intergenic
935738103 2:106122336-106122358 AGCCTGCCCTGCCCATCTCAGGG - Intronic
935785026 2:106541071-106541093 CACCAAGCCTGCCCACCACAGGG - Intergenic
936792767 2:116169280-116169302 AACCTGGCCTACCTAGCACAGGG + Intergenic
937888216 2:126915086-126915108 AGCCAGGCCTGTGCTACACAGGG + Intergenic
938155893 2:128939684-128939706 AGCAAAGCCTGCCCAACAGAGGG - Intergenic
938378830 2:130825436-130825458 AGCCAGGCCTGCCCCTGAGATGG + Intergenic
938408578 2:131046074-131046096 ACCCAGCCCTGCCCAGCAACCGG + Exonic
938653106 2:133403981-133404003 AGCCTGGGCTGCCCAGCTGAGGG - Intronic
939420328 2:141959298-141959320 AGCCAGGGCTGCCCAAAGCAAGG + Intronic
941846916 2:170142472-170142494 AGGCAGGCCTGCCCAGCCTGTGG - Intergenic
946174860 2:217916354-217916376 GCCCAGGCAGGCCCAGCACAGGG - Intronic
946386231 2:219386107-219386129 AGCCAGGCCAGGTCAGCCCAGGG + Intronic
947574088 2:231258683-231258705 AGCCAGACCTCCCTAGCATAGGG - Intronic
948055104 2:235005203-235005225 AGACAGACATGGCCAGCACAGGG - Intronic
948588337 2:239035111-239035133 AGCCATCCCGGCCCAGCACGAGG + Intergenic
948756794 2:240164805-240164827 TGCAGGGCCTCCCCAGCACAGGG + Intergenic
1168887898 20:1272922-1272944 AGCCACGCCTCCCTACCACAGGG + Intronic
1168993352 20:2113526-2113548 AGCCTGGTCTGCCTAGAACATGG + Intronic
1169216979 20:3799805-3799827 AGCCAGGCCAGCTCCTCACAGGG + Intronic
1170746572 20:19104498-19104520 AGCCGGGCTTGCCCACCACTGGG - Intergenic
1170983676 20:21238817-21238839 AGCCAGGCCTTCCAAGAGCAGGG - Intronic
1171028599 20:21655312-21655334 AGTAAGGCCTGTTCAGCACAGGG + Intergenic
1171305498 20:24102471-24102493 AGCCATGCCAGGCCAGCAGAGGG + Intergenic
1171503106 20:25610061-25610083 AGCGAGTCCTGACCAGCAGAGGG + Intergenic
1172082612 20:32354187-32354209 AGTTAGGGCTGCCCATCACATGG + Intergenic
1172838646 20:37888722-37888744 AGCCAGGCCTGATCAGAACCCGG - Intergenic
1172882968 20:38213555-38213577 GCCCAGGCCTGCCCGGCTCAGGG + Exonic
1173332156 20:42084580-42084602 AGCCAGGCCTGCCTAGGACTGGG + Intronic
1174330675 20:49814834-49814856 ATCCCTGCCTGCACAGCACAAGG - Intronic
1175455435 20:59109154-59109176 AGCCAGGCCTTACCAGCAACTGG - Intergenic
1175785843 20:61711408-61711430 AGCCAGGCCTGCCAACTACTTGG - Intronic
1175858296 20:62134623-62134645 AGTCAGGCAGGGCCAGCACAGGG + Exonic
1175939248 20:62530393-62530415 AGCCAGCTCTGCCCAGCTCCAGG + Intergenic
1176167824 20:63683252-63683274 TTCCATGCCTGCCCAGCAGAAGG + Intronic
1176649392 21:9531144-9531166 AGCCAGCCCTCCCCACCAAAGGG - Intergenic
1178906877 21:36643920-36643942 AACCAGGCCTGCTGAGGACACGG - Intergenic
1179390966 21:40990659-40990681 AGCCAAGCCTGCCCAGAACCAGG - Intergenic
1179743540 21:43430860-43430882 AGCGCTGCCTGCTCAGCACAGGG - Intergenic
1179805246 21:43833110-43833132 AGACAGCCCTTCCCTGCACAGGG + Intergenic
1180065524 21:45410290-45410312 TGCCTGCCCTGCCCATCACAAGG - Intronic
1180077236 21:45468978-45469000 AGCCAGGCCGGCCAAGAACCCGG - Intronic
1180141494 21:45896063-45896085 GGCGAGGCCTGGTCAGCACATGG + Intronic
1180833005 22:18915543-18915565 GGCCAGCACTGCCCAGCACTCGG - Intronic
1181066815 22:20310711-20310733 GGCCAGCACTGCCCAGCACTCGG + Intergenic
1181102421 22:20550302-20550324 AGCGAGGCCTGGCCAGAACAAGG - Intronic
1181105523 22:20572512-20572534 AACCAGGTGTGCACAGCACAAGG - Intronic
1181309668 22:21937797-21937819 AGGCAGTGCTGCCCAGCCCACGG + Intronic
1181404600 22:22673732-22673754 ACCCAGGCCAGCCCTGCTCATGG - Intergenic
1183374897 22:37457449-37457471 AGCCAGGCCTGCCTTGCCCTGGG + Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183737964 22:39654316-39654338 GGGCAGCCCTGCCCAGCTCAGGG - Intronic
1183744929 22:39686562-39686584 AGCCAGGCCTGCGTGGCCCATGG + Exonic
1184115366 22:42418844-42418866 AGCCAGGCCAGGCCAGCGCCCGG - Intronic
1184276768 22:43413096-43413118 AGCCAGGCCAGCCCAGCACTGGG - Intronic
1184750721 22:46484726-46484748 AGCCGGACCTCCCCAGCACCTGG - Intronic
1185182851 22:49373042-49373064 TGGCTGGCCTGCCCAGCACCCGG - Intergenic
1185364707 22:50432176-50432198 AGCCAGCCCTGCCCAGTCCAGGG + Intronic
1203283089 22_KI270734v1_random:140847-140869 GGCCAGCACTGCCCAGCACTCGG - Intergenic
950128346 3:10524956-10524978 AGCCTCCCATGCCCAGCACAGGG - Intronic
950182838 3:10927259-10927281 GGCCAGGCCTGCCTGGCAGAGGG + Intronic
950873296 3:16247844-16247866 AGCCAGGCCTCATGAGCACAAGG - Intergenic
952845560 3:37685236-37685258 TGCCAAGCCTGCCCAGCTTAGGG + Intronic
952889525 3:38030842-38030864 TGACAGGCCTGCCCAGGGCAGGG - Intergenic
953889146 3:46737465-46737487 AGCCAGTGCTGCCAAGGACACGG + Intronic
954279215 3:49564099-49564121 AGCCTGGACTGCCCTGCCCAAGG + Intronic
954453864 3:50586457-50586479 AGCCAGGCCTGCCTGCCACGGGG - Intergenic
954711638 3:52507858-52507880 AACCAGGGCTGCCTAGCAAAGGG + Intronic
957086496 3:75684165-75684187 AGCAAGGCCAGGTCAGCACAGGG + Intergenic
960174467 3:114500616-114500638 AGACAGTACTTCCCAGCACAAGG + Intronic
961382150 3:126501900-126501922 AGGGAGGCCGGCCCAGCCCAGGG + Exonic
961591538 3:127985156-127985178 AGCCAGGACTACCCTGCAGATGG - Exonic
961713268 3:128843013-128843035 AGCCAGGCCTGCTTCCCACAGGG + Intergenic
962750887 3:138434241-138434263 AGCCAGGCCTCCCCAGCCTCAGG - Intergenic
964791082 3:160453462-160453484 CCCCAGGCCTGCCCAGCATGTGG + Intronic
965099063 3:164273785-164273807 CTCCAAGCCTGCCCAGCACTAGG + Intergenic
968607212 4:1541200-1541222 GCCCAGGCCTGCCCAGCTCGGGG + Intergenic
968897910 4:3415561-3415583 AGCCAGGCCGGGCCAGGCCAAGG - Intronic
968963720 4:3758891-3758913 ACCCAGGGCTGCCCAGTGCAGGG + Intergenic
968979171 4:3837423-3837445 AGGCAGGCCTTCCCAGCATGGGG + Intergenic
969050689 4:4370810-4370832 AGCCAGGCCTGACGACCCCAGGG - Intronic
970600759 4:17639416-17639438 AGCCAGGCTTGCCCAGCTCCAGG + Intronic
972935462 4:44129181-44129203 AGACCAGCCTGGCCAGCACAGGG + Intergenic
976068340 4:81215065-81215087 AGCCAGCCCCGCCGTGCACACGG + Exonic
976379640 4:84384566-84384588 AGCCAAGCCTGCCCTGGACCTGG - Intergenic
979860090 4:125682857-125682879 AGCCGGGGCTGCCAAGCACGGGG - Intergenic
980197274 4:129606283-129606305 AGCCAGGCCTGTATAGTACAGGG - Intergenic
980963927 4:139502473-139502495 AGCCAGGCTTGCCCCGCTCTTGG - Intronic
982574810 4:157096199-157096221 AGCCAGGCCTTCCCCAGACAGGG - Intronic
983894951 4:173071345-173071367 CTCCAGACCTGCCCAGCACCAGG - Intergenic
984815280 4:183830575-183830597 AGCCAGGCCAGACCAGCCCTGGG - Intergenic
984901461 4:184590436-184590458 AGCCAGGCCCAACCAGCCCACGG + Intergenic
984961201 4:185100248-185100270 AGCCAGGGCTAGTCAGCACAGGG - Intergenic
985509500 5:304887-304909 GACCAGGCCTGGGCAGCACAGGG - Intronic
985679007 5:1246328-1246350 AGCCAGCCCGGCCAAGCGCAGGG - Intergenic
986104456 5:4646296-4646318 AGCCAGGTCTGCCCCACAGACGG + Intergenic
986346115 5:6837029-6837051 AGCCAGACCCACCCAGCACAAGG - Intergenic
986631905 5:9782171-9782193 TGCCAGGCCTGCCCTGTGCATGG - Intergenic
986668721 5:10125320-10125342 AGCGAGGCCCGGCCAGCACCTGG + Intergenic
986821022 5:11467002-11467024 AGCCAGGACAGCTCAGGACATGG + Intronic
992212602 5:74495439-74495461 AGCCAGGCATGCTCAAGACAGGG + Intergenic
997195410 5:131975726-131975748 AGCCAGGGGAGCCCTGCACAAGG + Intronic
997430024 5:133831125-133831147 AGCCAAGGCTGTCCACCACAAGG + Intergenic
997591148 5:135073029-135073051 AGCCAGGTGTGCCCAACAAAAGG - Intronic
997610596 5:135213107-135213129 AGCGAGGCCTGCTCAGGACTGGG - Intronic
997743409 5:136277828-136277850 GGCCATTCCTGCCCAGAACATGG + Intronic
998167111 5:139850513-139850535 AGCCAGGCCTGCCCAGCACAGGG + Intronic
998388530 5:141772413-141772435 AGCCAGGGCTGCACCCCACATGG - Intergenic
998958694 5:147462964-147462986 AGCCACAAATGCCCAGCACAAGG + Intronic
999175106 5:149626649-149626671 AGCCAGCCAGGGCCAGCACATGG - Intronic
999323205 5:150627189-150627211 AGGCAGGGCTGCCCAGATCAGGG + Intronic
999357974 5:150955244-150955266 TTCCAGGTCTGCCCAGCACCAGG - Intergenic
999725121 5:154430645-154430667 AGCCTGGTCTGCCCAGCTTAGGG + Intergenic
999767800 5:154754806-154754828 GGCCAGGCCCGCCGGGCACAGGG + Intronic
1000293927 5:159896768-159896790 AGAGAGTACTGCCCAGCACAGGG + Intergenic
1001111904 5:168903629-168903651 AGCCATGCATGCACAGCAGAAGG - Intronic
1001589496 5:172855691-172855713 AGCCAGGCCCGTCCAGCACGTGG + Intronic
1001820248 5:174704656-174704678 AGCCTGGCCTGGCCAGCTGATGG + Intergenic
1002309511 5:178306188-178306210 AGCCGGGACTGCCCAGCATGGGG + Intronic
1003053270 6:2798497-2798519 AGGCTGCCCCGCCCAGCACAGGG + Intergenic
1004093827 6:12532849-12532871 AGTCCAGCCTGCCCAACACAGGG - Intergenic
1006153183 6:32000258-32000280 AGCCAGGCTTCCCCAGCTGATGG - Intronic
1006159491 6:32032995-32033017 AGCCAGGCTTCCCCAGCTGATGG - Intronic
1007299427 6:40855716-40855738 AGCCAAGCATGCCAAGCACGGGG + Intergenic
1007731635 6:43951119-43951141 TGCCCTGCCTGCCCAGCTCATGG - Intergenic
1007765887 6:44159458-44159480 AGCCAGCCTTGGCCAGCAGAAGG + Intronic
1010160901 6:72853635-72853657 AGCCAGGGCTGCCCCACAGAAGG - Intronic
1011274922 6:85621405-85621427 AGACCGGCCTGGGCAGCACAGGG + Intronic
1011692461 6:89882881-89882903 TGTCAGGCCTGCTCAGCTCATGG + Intergenic
1011781438 6:90794332-90794354 GGCCAGGCCTGGTCAGCACTTGG - Intergenic
1012972863 6:105750274-105750296 AGTCAGGACTACCCAGCCCAGGG + Intergenic
1013159050 6:107523639-107523661 AGCCAGTCCTGCCAAGCAGCAGG - Intronic
1013306916 6:108856637-108856659 ATCCAGGTCAGCCTAGCACAAGG - Intronic
1014047808 6:116913258-116913280 AGACAAGCCTGGCCAGCATAGGG - Intronic
1016385308 6:143525074-143525096 AGCATGGCCTGCTCTGCACAGGG + Intergenic
1016896715 6:149060734-149060756 AGCCAGAGATTCCCAGCACACGG - Intronic
1017769925 6:157637120-157637142 ATCCAGCCCTACTCAGCACATGG - Intronic
1018182085 6:161232810-161232832 AGTCAAGCCTGCCCTGGACAAGG + Intronic
1018733663 6:166671756-166671778 AGCAGAGGCTGCCCAGCACATGG + Intronic
1018933034 6:168254677-168254699 AGTGAGACCTGCCCAGGACAGGG + Intergenic
1018949526 6:168370342-168370364 GGCCAGGCCTCCCCAGCTCCGGG - Intergenic
1019151805 6:170011356-170011378 AGCCAGGCCTGGCCAACAGCCGG + Intergenic
1019178388 6:170172589-170172611 AGACAGGCCTGCACAACACAGGG - Intergenic
1019373542 7:676588-676610 AGCCGGGCCTTCCCAGAGCAGGG + Intronic
1019469649 7:1211892-1211914 AGCCAGGACTGTCCAGACCAGGG + Intergenic
1020017346 7:4838648-4838670 ATGCAGGCCTACCCAGCACCAGG - Intronic
1022446101 7:30471916-30471938 AACCAGGCCTGCCCAGCCCACGG - Intronic
1022840604 7:34160705-34160727 AGGCAGGCCTCCACAGCCCATGG + Intergenic
1024157341 7:46638805-46638827 AACCAGACCTGCCCAGCTCAGGG - Intergenic
1024525870 7:50348889-50348911 GGCCATGCCTGCCCATGACAAGG - Intronic
1026863834 7:73810741-73810763 AGCCAGGCCCTCCCACCCCAGGG - Intronic
1026902473 7:74044744-74044766 AGCCAAGGCTGCCCAGCCCCAGG + Intronic
1029415784 7:100442334-100442356 AGCCTGGCCTCCCCAGCATCAGG + Intergenic
1032882021 7:136100259-136100281 CAGGAGGCCTGCCCAGCACAGGG + Intergenic
1033448426 7:141441590-141441612 ATCCAGGCCTGGCCAGCTCCAGG - Intronic
1033613226 7:142985847-142985869 ATCCAGGCCTGACTAGCACAAGG + Intergenic
1034979583 7:155467376-155467398 CGCCAGGCCTGCCCGACCCAGGG - Intergenic
1035887775 8:3310389-3310411 AGGCAGTCCTGCCCAGCATTGGG + Intronic
1039967281 8:42292545-42292567 AGGCAGGCTTGGCCAGCACATGG + Intronic
1042797584 8:72681401-72681423 ACCCAGGCCTACACAGCACCAGG + Intronic
1045394900 8:101750799-101750821 AGGCAGGCCTGCTCATCACCTGG - Intronic
1046441070 8:114255166-114255188 AGACTGGCCTGCCCAGCCCATGG + Intergenic
1048303412 8:133267382-133267404 ACCCGGGCCCGCCCAGCACGGGG + Intronic
1048892342 8:138959317-138959339 AGCCAGGCCTGCAAAGGACCTGG + Intergenic
1049210251 8:141383083-141383105 TGTCAGGCCTGCACAGGACAAGG - Intergenic
1049261153 8:141639918-141639940 AGGCTGGGGTGCCCAGCACACGG + Intergenic
1049290817 8:141800755-141800777 AGGCTGGCCTGTCCTGCACATGG - Intergenic
1049310811 8:141932867-141932889 AGCCTGGGCTGCCTCGCACAGGG + Intergenic
1049380655 8:142314143-142314165 TGTGAGTCCTGCCCAGCACATGG + Intronic
1049388446 8:142355875-142355897 ATCCAGCCCTGCCCAGAGCAGGG + Intronic
1049421419 8:142518253-142518275 AGACATGCATGCCCAGCACCTGG - Intronic
1049786627 8:144454041-144454063 AGCCAAGCTGGCCCAGGACAAGG + Intronic
1049799113 8:144509601-144509623 AGCCCGGCCTGGCCAGCTCCAGG - Exonic
1050885448 9:10759077-10759099 TGCCTGGCCTGCCCAGGAAAGGG + Intergenic
1051276724 9:15406024-15406046 AGACCGGCCTGGCCAACACAGGG - Intergenic
1051498567 9:17752233-17752255 AGACAGACCTTCCCAGGACACGG + Intronic
1052470289 9:28885293-28885315 AGAGAGGCCTGGCCAGCAAATGG + Intergenic
1052748141 9:32461617-32461639 GCTCAGGCCTGCCCAGCACAGGG + Intronic
1052932980 9:34070812-34070834 AGCCAGAACTGACCAGCACCTGG - Intergenic
1053258578 9:36640988-36641010 AGAGAGGTCTGCCCAGCACAAGG - Intronic
1056289582 9:85129139-85129161 AGCATGGCCTGCTCAGCACATGG + Intergenic
1057186470 9:93059969-93059991 AGCAAGGCCTGCCCAGGGCCTGG + Intronic
1058854584 9:109048686-109048708 AGACAGGCCTGCTCTGCAAAAGG + Intronic
1059698204 9:116748744-116748766 ACCCAGTCCTGCCCTGGACAGGG + Intronic
1059757454 9:117306926-117306948 AGGCACACCTGCCCATCACAAGG - Intronic
1060253631 9:122005893-122005915 TGGCAGGACTGCCCAGCTCATGG - Intronic
1060482629 9:124026113-124026135 CTCCAGCCCTGCCCGGCACATGG - Intronic
1061403629 9:130382028-130382050 GGCCTGTCCTGCCCAGCTCACGG - Intronic
1061512812 9:131071306-131071328 AGCCAATCCTGCCCACCCCATGG - Intronic
1061625688 9:131839374-131839396 GGGCAGGCCTGGCCAGGACAGGG + Intergenic
1061804263 9:133129270-133129292 TGCCAGGCCTGCCGTGCCCAGGG - Intronic
1062216524 9:135392483-135392505 AGCCAGGCCTCACCAGCACATGG - Intergenic
1062333545 9:136055108-136055130 ATCCAGGCCTGCCCTGCCCTGGG + Intronic
1062358238 9:136175194-136175216 AGCCAGGCCTGCCCAGCCCACGG - Intergenic
1062394794 9:136348425-136348447 AGCCGGGCCCTTCCAGCACAGGG + Intronic
1062423720 9:136496623-136496645 ACCAGGGCCTGCCCAGCACCCGG - Exonic
1062437075 9:136551105-136551127 GGCCAGGCCTGCCCAAATCAGGG + Intergenic
1062451202 9:136616511-136616533 AGCCAGGCCAGCCCCTCACACGG - Intergenic
1062615029 9:137392466-137392488 AGCGAGGCGGGGCCAGCACAGGG + Intronic
1062636131 9:137492699-137492721 AGCCCTGCCTACCCAGCCCATGG - Intronic
1062726177 9:138074933-138074955 AGCCAAGTTTGCCCAGCGCAAGG - Intronic
1203627133 Un_KI270750v1:34692-34714 AGCCAGCCCTCCCCACCAAAGGG - Intergenic
1185703336 X:2248097-2248119 AGACCAGCCTGCCCAACACAGGG + Intronic
1187543361 X:20221962-20221984 AGCCAGGCCTGGCCAGCCTAAGG + Intronic
1187900477 X:24023194-24023216 AGCCAAGCCTGCCCTGATCAAGG + Intronic
1189143848 X:38635908-38635930 ATAAAGGCCTGCACAGCACAGGG - Intronic
1190297027 X:49033678-49033700 AGGCAGGCCTGCACAGCACCCGG + Intronic
1191854172 X:65609361-65609383 GCTCAGGCCTGCCCAGAACAAGG + Intronic
1192177352 X:68894390-68894412 AGCCAGGCCTGACCCGGAGAGGG + Intergenic
1192737537 X:73863454-73863476 CTCCAGGCCTGCCCAGCACCAGG + Intergenic
1192938591 X:75888018-75888040 CGCCAGGACTGCCCAGGCCAAGG + Intergenic
1194292840 X:92096604-92096626 TGTGAGGCCTCCCCAGCACATGG - Intronic
1196789232 X:119449213-119449235 AGACCAGCCTGCCCAACACAGGG + Intronic
1197837567 X:130711855-130711877 AGCCAGGCCAGCCCTCCAGATGG + Intronic
1199606857 X:149585180-149585202 AGCCACACCTGGTCAGCACAGGG - Intronic
1199632266 X:149784188-149784210 AGCCACACCTGGTCAGCACAGGG + Intronic
1200045197 X:153397270-153397292 GCCCAGGCCTCCCCAGCCCAGGG - Intergenic
1200610345 Y:5321158-5321180 TGTGAGGCCTCCCCAGCACATGG - Intronic
1201175750 Y:11307577-11307599 AGCCAGGCCGCGCCAGCAGAGGG + Intergenic