ID: 998168174

View in Genome Browser
Species Human (GRCh38)
Location 5:139856276-139856298
Sequence CAGAGATAGCAGGCCTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 366}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998168174_998168180 7 Left 998168174 5:139856276-139856298 CCCCTCCAGGCCTGCTATCTCTG 0: 1
1: 0
2: 3
3: 39
4: 366
Right 998168180 5:139856306-139856328 GAAGCCCGCCAGTGGCACCATGG 0: 1
1: 0
2: 1
3: 5
4: 95
998168174_998168185 23 Left 998168174 5:139856276-139856298 CCCCTCCAGGCCTGCTATCTCTG 0: 1
1: 0
2: 3
3: 39
4: 366
Right 998168185 5:139856322-139856344 ACCATGGACCCCTGGCATCTAGG No data
998168174_998168179 -1 Left 998168174 5:139856276-139856298 CCCCTCCAGGCCTGCTATCTCTG 0: 1
1: 0
2: 3
3: 39
4: 366
Right 998168179 5:139856298-139856320 GCTTGTGAGAAGCCCGCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 69
998168174_998168184 15 Left 998168174 5:139856276-139856298 CCCCTCCAGGCCTGCTATCTCTG 0: 1
1: 0
2: 3
3: 39
4: 366
Right 998168184 5:139856314-139856336 CCAGTGGCACCATGGACCCCTGG 0: 1
1: 0
2: 3
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998168174 Original CRISPR CAGAGATAGCAGGCCTGGAG GGG (reversed) Intronic
900561798 1:3310670-3310692 CAGAGGAGGAAGGCCTGGAGAGG - Intronic
901624455 1:10616132-10616154 CAGAGACGACAGGGCTGGAGGGG - Intronic
901649996 1:10737827-10737849 CAGGAAGAGCAGGCCTGGAGTGG - Intronic
902306716 1:15546012-15546034 AAGAGCAAGCTGGCCTGGAGTGG + Intronic
902511520 1:16969389-16969411 CAGTAAGAGCAGGCTTGGAGGGG + Intronic
902518748 1:17004170-17004192 CAGAGATCCCAGGCCTGGAGGGG + Intronic
903623610 1:24715466-24715488 CTGGGGTAGCAGGCATGGAGAGG - Intergenic
903671771 1:25040148-25040170 CAGAGATAGCTGGGCATGAGGGG + Intergenic
903802788 1:25982136-25982158 CAGAGAAACCAAGCCAGGAGAGG + Intronic
904028406 1:27519337-27519359 CAGAGACAACAGGCCTGGCAGGG - Intergenic
904593013 1:31625677-31625699 CAGAGAGGAGAGGCCTGGAGTGG - Intronic
905091755 1:35435906-35435928 CTGAGATAGCAGGACTAGAGTGG + Intronic
905467272 1:38164728-38164750 CTGAGAAGGCATGCCTGGAGAGG - Intergenic
906167292 1:43696212-43696234 CAGAGAAGGCAGGGCTGGTGTGG + Intronic
906283924 1:44573487-44573509 CATGGAAAGCAGACCTGGAGTGG + Intronic
906557885 1:46728798-46728820 CAGAGATGCCCTGCCTGGAGAGG - Intergenic
907776485 1:57521137-57521159 CAGAGAAAGCTTGTCTGGAGAGG - Intronic
909698595 1:78494456-78494478 CAGAGATAGCAATCCAGGTGGGG + Intronic
909944640 1:81649725-81649747 TAGAGAAAACAGGCTTGGAGGGG + Intronic
910028173 1:82683226-82683248 CAGAGATAACAGTACTGGTGTGG - Intergenic
910921005 1:92346972-92346994 AAGAGAAAGCAGGGCTGGAGAGG - Intronic
913225428 1:116694492-116694514 AAGAGCTACCAGGCCTGGAGGGG - Intronic
914429502 1:147608021-147608043 CAGATAAAGAAGGCCTGGAGAGG + Intronic
915513943 1:156402010-156402032 CAGAGATGTCAGGACTGGGGTGG - Intergenic
915559967 1:156681417-156681439 AAAAGACAGCCGGCCTGGAGCGG - Intergenic
916768378 1:167883756-167883778 CAGAGCCAGCATGCCTGAAGTGG + Intronic
917109288 1:171528654-171528676 AAAAGAAAGCATGCCTGGAGAGG - Intronic
917719966 1:177777974-177777996 TAAAGAAAGCAGGCCTAGAGAGG + Intergenic
918178747 1:182068031-182068053 CAGGGATAGAAGGTCTGGGGAGG + Intergenic
918416964 1:184320037-184320059 CAGTGGGAGCAGGACTGGAGGGG - Intergenic
920433856 1:205935889-205935911 CAGAGAGAGAAGGCCTGGGCTGG - Intronic
924855201 1:247868835-247868857 CAAAGGTAGCAGGCCTAGAAAGG - Intronic
1063492598 10:6478562-6478584 CAGAAAAAGCAGCCTTGGAGTGG - Intronic
1063640633 10:7827130-7827152 CACACATAGAAGGCCTGAAGGGG + Intronic
1064506864 10:16040779-16040801 AAGAGAAAGCAGGCCGAGAGTGG + Intergenic
1066067814 10:31774941-31774963 CAGAGCTGGAAGGACTGGAGGGG - Intergenic
1067288892 10:44927274-44927296 CAGAGACAGCAAGTCTGGAAAGG + Intronic
1067530204 10:47065517-47065539 CAAAGATAGCAGGCATGGAGAGG + Intergenic
1069626261 10:69869399-69869421 CAGAGATAACAGGGCTGAGGAGG - Intronic
1070016936 10:72542927-72542949 CAGAGACAGCTGGACTTGAGAGG - Intronic
1070074499 10:73121987-73122009 ATGAGAAAACAGGCCTGGAGAGG + Intronic
1072049181 10:91686746-91686768 GAGAGAGAACTGGCCTGGAGGGG + Intergenic
1072466663 10:95669771-95669793 AAGAGTTAGCAGGCCGGGCGCGG + Intronic
1072799784 10:98384967-98384989 CAGAGATACAGGCCCTGGAGAGG + Exonic
1073250284 10:102117090-102117112 CAGTGATTTGAGGCCTGGAGGGG - Intronic
1073321802 10:102620238-102620260 AAGAGATAACAGGCCTGGGCTGG - Intronic
1074629824 10:115239923-115239945 GAGATATCGCTGGCCTGGAGTGG + Intronic
1075522117 10:123149296-123149318 CAGGGAGAGGAGGTCTGGAGGGG - Intronic
1075741212 10:124697627-124697649 CAGGGAGATCAGGGCTGGAGGGG + Intronic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1078326746 11:10387448-10387470 GAGAGAGAGCTGGCCTGCAGTGG + Intronic
1078709912 11:13781209-13781231 CAGAGATGGCAGGCCGGTTGGGG - Intergenic
1078920494 11:15826162-15826184 AGGAGAGAGCAGGCCTGGAGAGG - Intergenic
1080003320 11:27376307-27376329 TAGAGATATCAGGCCTTGAAAGG + Exonic
1081431090 11:42977429-42977451 CTGATCTGGCAGGCCTGGAGTGG - Intergenic
1081795041 11:45813039-45813061 AAGAGGCAGCAGGGCTGGAGAGG + Intergenic
1082160154 11:48881741-48881763 CAGGGATAGCCGGCTTGGAAAGG - Intergenic
1082162212 11:48898665-48898687 CAGGGATAGCCGGCTTGGAAAGG + Intergenic
1082235754 11:49819539-49819561 CAGGGATAGCCGGCTTGGAAAGG - Intergenic
1082242935 11:49890257-49890279 CAGGGATAGCCGGCTTGGAAAGG + Intergenic
1082609261 11:55279468-55279490 CAGGGATAGCCGGCTTGGAAAGG - Intergenic
1082657434 11:55871068-55871090 CAGGGATAGCCGGCTTGGAAAGG + Intergenic
1083398274 11:62406212-62406234 AAGAGATCTCAGGCCTAGAGAGG - Intronic
1083516193 11:63261498-63261520 CAGAGATGCCCTGCCTGGAGAGG + Intronic
1084793368 11:71489051-71489073 CAGAGAGAGCAGGAGGGGAGGGG + Intronic
1084959869 11:72710784-72710806 CAGCGGGAGCAGGCTTGGAGGGG - Intronic
1085038437 11:73313201-73313223 CAGAGAGAGCAGGCAGGGAGTGG + Intronic
1085216935 11:74841278-74841300 AAGAGAAAGCAGGTCTGGGGCGG + Exonic
1085263996 11:75225587-75225609 CAGAGAGAGCAGGAGGGGAGTGG - Intergenic
1085389188 11:76173660-76173682 GAGACAGAGCAGGCCCGGAGGGG + Intergenic
1085463141 11:76707180-76707202 GAGAGAAATGAGGCCTGGAGAGG - Intergenic
1085540700 11:77266611-77266633 CAGGGATAACATGCATGGAGCGG - Intronic
1088244513 11:107804124-107804146 CTTAGATTGCAGGCCTGGTGCGG - Intronic
1088754390 11:112873638-112873660 AAGACATAGCAAGCCTGGAGAGG - Intergenic
1090242098 11:125191389-125191411 CAAAGAGAGCAAGCCAGGAGTGG + Intronic
1091009035 11:131981718-131981740 GAGAGAAAACAGGCCTGGTGCGG + Intronic
1091418341 12:311351-311373 CACAGTTAGCAGGCCAGGCGTGG + Intronic
1091479203 12:809052-809074 GAGAGATAGGAGGCCAGGTGCGG - Intronic
1091646795 12:2278419-2278441 AAGAGATAGCAGGGGTGGGGAGG - Intronic
1091667720 12:2431197-2431219 CTGACCTAGCAGGTCTGGAGTGG + Intronic
1093712288 12:22340595-22340617 GAGAGATAGAAAGCCTAGAGGGG - Intronic
1095336324 12:41032183-41032205 CATAGATAATAGGCCTTGAGAGG - Intronic
1095740159 12:45597998-45598020 AAGAGATATCAGGCCGGGAGTGG + Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096546645 12:52344723-52344745 CAAGGACAGCAGGGCTGGAGAGG + Intergenic
1096694193 12:53338455-53338477 AAGAGATAGCAGGTGAGGAGGGG + Intronic
1097039003 12:56143172-56143194 GAGAGATGGCAGGCTTGGAAAGG + Intronic
1098683178 12:73383806-73383828 CAGACATAGCAGAACTTGAGGGG + Intergenic
1098904091 12:76144012-76144034 AAGAGATAGTATGCATGGAGAGG - Intergenic
1098970878 12:76855657-76855679 TAGAGTTTGCAGGACTGGAGAGG - Intergenic
1100247387 12:92773964-92773986 GACAGACAGAAGGCCTGGAGTGG + Exonic
1100362024 12:93888133-93888155 TAGAGATGGCAGGCCGGGCGCGG + Intronic
1100828084 12:98493383-98493405 CAGAGAGGGAAGGGCTGGAGTGG - Intronic
1101096870 12:101351070-101351092 CAGAGATCACTGGCCTGCAGTGG + Intronic
1101838003 12:108308540-108308562 CAGTGATGGGAGCCCTGGAGGGG - Intronic
1102755240 12:115334517-115334539 CTGAGGCAGCAGGTCTGGAGTGG + Intergenic
1102765672 12:115430931-115430953 CAGGGTTAGCAGGGATGGAGTGG - Intergenic
1102857606 12:116307644-116307666 CAGAGAAAGGAGCACTGGAGTGG - Intergenic
1103217401 12:119212621-119212643 CAGAGAGAGGAGGCTTGGAGTGG - Intronic
1103716846 12:122950024-122950046 CAGGGATGCCAGCCCTGGAGTGG - Intronic
1103718702 12:122961931-122961953 CAGAGATAGAAGGCCTGACGTGG - Intronic
1107669409 13:42728633-42728655 AAGAGCTAGCAGGCTTGGACAGG + Intergenic
1108061510 13:46537936-46537958 GAGAGATAGGAGGGCAGGAGAGG + Intergenic
1108672943 13:52710218-52710240 CACAGATAGCATGGTTGGAGAGG + Intronic
1108674012 13:52720985-52721007 CAGAGATGCCCTGCCTGGAGAGG + Intronic
1108945249 13:56014861-56014883 CAGAGATGGCTGGACTGGAGGGG + Intergenic
1109957656 13:69589726-69589748 CAAAGACAGCAGGCGTGAAGGGG + Intergenic
1117471180 14:56046565-56046587 CAGTGGTAGCAGGGCTGGAGAGG - Intergenic
1117841798 14:59869312-59869334 TAGAGCTAGAAGGCCTGGGGTGG - Intronic
1118303051 14:64632360-64632382 CCGAGAGAGCAGGCCAGGATAGG + Intergenic
1118900036 14:69979011-69979033 CTGAGATGGGAGTCCTGGAGAGG - Intronic
1118907574 14:70033712-70033734 CAGAGATACCCAGCCTGGCGTGG + Intergenic
1118922452 14:70161870-70161892 CAGAGAAAGCATCCCTGGAAGGG + Intronic
1119212790 14:72845442-72845464 CATAGATGCCAGGCCTGGGGAGG - Intronic
1121097027 14:91224645-91224667 CAGAAATAGAAGGAGTGGAGGGG - Intronic
1121337859 14:93088178-93088200 CAGGGAGAGCAGGCCTGGGTGGG - Intronic
1121392796 14:93590366-93590388 CAGACATGGCTGACCTGGAGTGG + Intronic
1122364041 14:101183734-101183756 CAGATACTTCAGGCCTGGAGTGG - Intergenic
1124037663 15:26070971-26070993 CATAGAAGCCAGGCCTGGAGTGG - Intergenic
1124343585 15:28905679-28905701 CAGAGATATCAAGCCAGGTGCGG - Intronic
1124529802 15:30495709-30495731 CAGAAATAGCAGGCAAGCAGAGG + Intergenic
1124768857 15:32511979-32512001 CAGAAATAGCAGGCAAGCAGAGG - Intergenic
1125810690 15:42538585-42538607 CAGAAATAGAAGGCTTGGAGTGG - Exonic
1126077225 15:44923142-44923164 CACAGAAAGCAAGCCAGGAGTGG - Intergenic
1126081490 15:44967723-44967745 CACAGAAAGCAAGCCAGGAGTGG + Intronic
1128386310 15:67151147-67151169 CTGAGATATAAGGCCTGGCGTGG - Intronic
1128753107 15:70162949-70162971 CAGAGCTGGCAGGACTGGGGTGG - Intergenic
1129692336 15:77720961-77720983 CTGGGTCAGCAGGCCTGGAGAGG + Intronic
1130038278 15:80381132-80381154 CTGATTCAGCAGGCCTGGAGAGG - Intronic
1130442016 15:83963857-83963879 CAGGCAAACCAGGCCTGGAGTGG + Intronic
1132143998 15:99416163-99416185 CAGAGAAAGCAGGCCTGGAATGG + Intergenic
1132718972 16:1306644-1306666 CAGAGAGGGCAGGGCTGGTGAGG - Intergenic
1134232054 16:12437002-12437024 CAGAGATGTCAGGCCTGGACTGG - Intronic
1134351123 16:13438876-13438898 CAGAGACAGCTGGGATGGAGCGG - Intergenic
1134904604 16:17969552-17969574 AAAAGATAGCAGGCATGAAGGGG - Intergenic
1135632274 16:24045727-24045749 CTGATTCAGCAGGCCTGGAGGGG - Intronic
1136420825 16:30131799-30131821 CAGAGATCCCATGCCAGGAGGGG - Intergenic
1137408284 16:48207193-48207215 AAGAGATGGCAGCCCAGGAGGGG + Intronic
1137716645 16:50602175-50602197 CAGAGATAACAGGTCCGCAGGGG + Intronic
1137759768 16:50930964-50930986 CGGAGATAGCAGGACTGGCTTGG - Intergenic
1138579567 16:57931961-57931983 CAGAGAAAGCATGTTTGGAGGGG + Intronic
1138706426 16:58920349-58920371 CAGAGATGCCCTGCCTGGAGAGG + Intergenic
1139559173 16:67730766-67730788 AAGAGACAGCAGGCTTGGAGAGG + Intronic
1139701106 16:68708530-68708552 CAGAGATGCCAGCCCTGAAGGGG + Intronic
1139956354 16:70694919-70694941 CAGAGGCAGCAGACCCGGAGGGG + Intronic
1140768098 16:78178573-78178595 AATAGATAGCAGGCCAGGTGCGG + Intronic
1141063320 16:80894976-80894998 CATAGATTGCATGTCTGGAGTGG + Intergenic
1141464455 16:84196799-84196821 CAGGGACTGCAGGGCTGGAGAGG - Intronic
1141717451 16:85734993-85735015 GTGAAATAGAAGGCCTGGAGGGG + Intronic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1142919177 17:3169611-3169633 CAGAGATAGTGGACTTGGAGGGG + Intergenic
1143211544 17:5191784-5191806 CAGTGATAGCGGCCGTGGAGGGG - Intronic
1143264287 17:5624189-5624211 CAGAGAAAGAAGCCCAGGAGGGG - Intergenic
1143817101 17:9525764-9525786 CAGAGATAGCAGGCCATGTGGGG - Intronic
1145790700 17:27624918-27624940 AAGGGATGCCAGGCCTGGAGAGG - Exonic
1146396447 17:32471672-32471694 AAAAGATAGCAGGACTGGAATGG + Intronic
1146459848 17:33037434-33037456 CAGCCACAGCAGGGCTGGAGGGG - Intronic
1146816276 17:35944585-35944607 CTGGGATAGAAGGCCTGCAGGGG + Intergenic
1147200557 17:38799068-38799090 CAGAGACACCAGGCCTCGCGTGG + Intronic
1147370801 17:39991444-39991466 AAGAAATACCTGGCCTGGAGCGG - Intronic
1147534581 17:41311285-41311307 GAGAGATAGCTGGTATGGAGAGG + Intergenic
1147561974 17:41514826-41514848 TGGGGATAGCAGGCCTGGATGGG - Intronic
1147670942 17:42176426-42176448 AGGAGATAGAAGGCCAGGAGAGG + Intronic
1147991021 17:44333557-44333579 CAGGGAAAGCTGGCCTGGGGCGG + Intergenic
1149050298 17:52296469-52296491 AAGATATAGCAAGCCTGGAGTGG + Intergenic
1149190751 17:54058338-54058360 AAGAGATAGTAGGCCGGGCGCGG - Intergenic
1150528351 17:65949448-65949470 CAGACAGATCAGGCCTGGTGAGG + Intronic
1150636741 17:66918468-66918490 CAGAGAGAGCAGGATGGGAGGGG - Intergenic
1150821327 17:68436522-68436544 GAGAGATTGCACGGCTGGAGAGG + Intronic
1152722584 17:81930149-81930171 CAGGGAGAGCAGGGCTGGACTGG - Intergenic
1153274560 18:3355254-3355276 ATGAGATAGCAGGCCTGGCGCGG - Intergenic
1154312034 18:13274253-13274275 CAGAGGGAGGAGGCCTGGATGGG + Intronic
1155926027 18:31656028-31656050 CAGACTCAGCAGGTCTGGAGCGG - Intronic
1156108154 18:33690934-33690956 CACAGAGAGGTGGCCTGGAGAGG - Intronic
1156763435 18:40621457-40621479 CAGAGATAGCAATTCTTGAGTGG + Intergenic
1157245072 18:46046483-46046505 CAGAATTAGCAGGGCTGGGGTGG - Intronic
1157901307 18:51520869-51520891 CAGAGACAGCAGGCTGGGAGGGG + Intergenic
1158920537 18:62187076-62187098 CAGAGAAGGAAGGCGTGGAGCGG - Intronic
1160288025 18:77564685-77564707 CACAGAGGGCTGGCCTGGAGAGG - Intergenic
1160436036 18:78853560-78853582 CAGAGCTGGCAACCCTGGAGTGG - Intergenic
1160526893 18:79543622-79543644 CAGGGAGACCAGGCCTGGGGAGG + Intergenic
1160582987 18:79898338-79898360 CAGTGATTCCAGGCCAGGAGAGG - Intronic
1160665796 19:327605-327627 CAGAGAGACCAGTCCTGGGGAGG + Intronic
1160883183 19:1331811-1331833 CAAAGATAGCCTGCCTGGAAGGG - Intergenic
1161826050 19:6566438-6566460 CAGAGATATCAGGCCAGGCATGG - Intergenic
1161848543 19:6726340-6726362 CAGAGATCACAGGTGTGGAGAGG - Intronic
1162829858 19:13277650-13277672 CAGAAACATCAGGCCTGGGGAGG - Intronic
1163115566 19:15187063-15187085 CAGAAACAGCACACCTGGAGGGG - Intronic
1165023775 19:32944596-32944618 GAGAGGGAGAAGGCCTGGAGAGG + Intronic
1166525095 19:43505541-43505563 TGGAGATAGTAGGCCAGGAGCGG - Intergenic
1166754445 19:45181682-45181704 CAGGGATATCAGGCTGGGAGAGG - Exonic
1168406726 19:56114409-56114431 CAGAGAGACCAGGCCTGGCCAGG - Intronic
1168415381 19:56164430-56164452 GAGAGAGACCAGGACTGGAGCGG - Intergenic
925320231 2:2960571-2960593 CAGAGCTAGCAAGTCTGGAGTGG + Intergenic
926203033 2:10814819-10814841 CAAACACAGCAGGCCTGGAGAGG - Intronic
927190380 2:20513100-20513122 CACAGATAGCAGGGTGGGAGTGG - Intergenic
927663021 2:25008805-25008827 GAGAGAAAGCAGGCCGGGTGTGG - Intergenic
927678615 2:25125103-25125125 CAGAAAGATCAGGCCTGGAGGGG - Intronic
929385786 2:41404495-41404517 CAGAGACAACAGGCCTGTTGAGG + Intergenic
931474139 2:62570752-62570774 CAGAGCCCGCAGGCCTGAAGCGG - Intergenic
931748828 2:65313550-65313572 CAGTGGTAGCAGGCCCGAAGGGG + Exonic
932088666 2:68785353-68785375 CAGAGATAGCAGTGATGAAGGGG + Intronic
932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG + Exonic
933762684 2:85683511-85683533 CAGAGAAAACAGGCCTGGCATGG + Intergenic
936912131 2:117604030-117604052 CAGAGACAGTAGGGGTGGAGGGG + Intergenic
937649879 2:124307902-124307924 CTGATCCAGCAGGCCTGGAGTGG - Intronic
937878973 2:126850874-126850896 ATGAGGAAGCAGGCCTGGAGAGG + Intergenic
938796782 2:134724425-134724447 GAGAGACAGCCTGCCTGGAGGGG + Intergenic
940119870 2:150252620-150252642 CAGAGGTTCCATGCCTGGAGGGG - Intergenic
941845321 2:170126360-170126382 CAGAGATAGCCTGCCCAGAGAGG - Intergenic
943734436 2:191339073-191339095 ATGAGAAAGCAGGCCTGGAGGGG + Intronic
945919207 2:215738127-215738149 TAGAGATAACATGACTGGAGAGG - Intergenic
946278754 2:218650859-218650881 CAGAGAAAACGGGCCAGGAGAGG - Intronic
947616375 2:231559700-231559722 GAAAGAAAACAGGCCTGGAGCGG + Intergenic
947899762 2:233711564-233711586 CAGAGAAGGCAGGCCTGCAAGGG - Intronic
948404638 2:237708045-237708067 CAGAAAGTGAAGGCCTGGAGAGG - Intronic
948505523 2:238424967-238424989 CAGAGCCAGCAGTGCTGGAGGGG - Intergenic
1169233049 20:3905635-3905657 AAGAGATAGCAGGCCGGGTGTGG - Intronic
1169353436 20:4888647-4888669 GAGAGATACCAGGCTGGGAGTGG - Intronic
1169571630 20:6912743-6912765 GTGAGATAGAAGGCCTGGGGTGG + Intergenic
1169900615 20:10548537-10548559 CACACAAAGAAGGCCTGGAGAGG - Intronic
1170418885 20:16172794-16172816 GAGAGAGAGGAGACCTGGAGGGG + Intergenic
1170454628 20:16520485-16520507 CAGAGATGCCAGGCCCAGAGGGG - Intronic
1170581716 20:17704306-17704328 CAGATTTAGTAGGTCTGGAGTGG + Intronic
1172771824 20:37386554-37386576 CAGAGATCACAGGCAGGGAGTGG - Intronic
1173736540 20:45365635-45365657 CATGGAGAGCCGGCCTGGAGGGG - Exonic
1174115036 20:48221027-48221049 AGGAGACAGCAGCCCTGGAGGGG - Intergenic
1174151360 20:48488711-48488733 CAGAGGTAGCAGAGCTGGGGAGG + Intergenic
1174820105 20:53719295-53719317 AAGAGACACCAGGCCTGGTGAGG + Intergenic
1175144936 20:56888595-56888617 GAGAGAGAGCAGGATTGGAGAGG + Intergenic
1175545874 20:59777440-59777462 CAGAGATCTCAGGGATGGAGGGG - Intronic
1175974007 20:62701401-62701423 CTGAGACAGCAGGCATGGGGTGG - Intergenic
1176269171 20:64226562-64226584 CACAGAGAGCAGGCCTGACGGGG + Intronic
1176412996 21:6458822-6458844 CCGAGAATGCAGGCCTGTAGAGG - Intergenic
1177947195 21:27485492-27485514 CACAGAAAGAAGGACTGGAGTGG + Intergenic
1178262614 21:31113994-31114016 CAGAGAAAGGAGGACAGGAGTGG + Intergenic
1179181438 21:39048384-39048406 AAAAGATAGGAGCCCTGGAGGGG + Intergenic
1179475317 21:41639515-41639537 CGGAGGCAGCAGGCCTGGGGTGG - Intergenic
1179688491 21:43067144-43067166 CCGAGAATGCAGGCCTGTAGAGG - Intronic
1179890686 21:44333774-44333796 GAGAAACAGCAGGCCTGGAGCGG + Intronic
1179952244 21:44715021-44715043 CAGAGTTAGCAGACCTGGGATGG - Intergenic
1180742370 22:18062944-18062966 CAGAAAAAGCAGGGTTGGAGGGG - Intergenic
1181312831 22:21954644-21954666 CAGAGAAAGCAGGGCTGGGGCGG + Intergenic
1181345938 22:22220716-22220738 CAGAGAAAGCAGGGCTGGGGCGG + Intergenic
1181533873 22:23531938-23531960 CAGAAACAGCAGGACAGGAGAGG + Intergenic
1181965976 22:26657169-26657191 CAGAGAGCTCAGGGCTGGAGAGG - Intergenic
1184298953 22:43543670-43543692 CAGAGAGGGCTGCCCTGGAGGGG + Intronic
1184455140 22:44605893-44605915 CAGAGAGAGGGCGCCTGGAGGGG + Intergenic
1184649731 22:45914052-45914074 CAGAGATGGCAGTGCAGGAGAGG - Intergenic
1184744581 22:46448902-46448924 CACAGATAGGAGGCCAAGAGGGG + Intronic
1184947397 22:47813353-47813375 GAGAGAGAGCATGCCTGAAGGGG + Intergenic
1185006377 22:48279151-48279173 CAGAGGTTGCAGCCCTGCAGAGG + Intergenic
1185206252 22:49540908-49540930 GAGAGGCAGCTGGCCTGGAGGGG - Intronic
1185359569 22:50397558-50397580 CAGAGATGACAGGGCTGGTGAGG - Intronic
949640415 3:6029988-6030010 CAGAGATACCTTGCCTAGAGAGG + Intergenic
950102995 3:10369531-10369553 CAGAGACATCAGGGCTAGAGAGG - Intronic
951365937 3:21782572-21782594 CGGAGATAGCAAATCTGGAGAGG - Intronic
951718643 3:25674703-25674725 CAGAGGCTCCAGGCCTGGAGTGG + Intergenic
951832190 3:26943048-26943070 CAGAGATGGCCTGCCTAGAGAGG - Intergenic
952495911 3:33915651-33915673 CTGATCTAGCAGGCCTGGGGTGG - Intergenic
952989066 3:38815397-38815419 CAGAGTCAATAGGCCTGGAGTGG + Intergenic
953844536 3:46416929-46416951 CAGAAAGAGCAGGGCAGGAGAGG - Intergenic
954124170 3:48518965-48518987 CTGTGAGAGCAGGCCTGAAGGGG + Exonic
954206535 3:49063330-49063352 CAGAGTTAGTAGGTCTGGAGTGG - Intronic
954218901 3:49140327-49140349 CAGAGAAAGCAGGAAGGGAGAGG - Intergenic
955414269 3:58678285-58678307 CAGAGATGCCATGCCTGGAGAGG + Intergenic
956201764 3:66713809-66713831 CAGGGATAACAGGACAGGAGGGG - Intergenic
959193726 3:103149738-103149760 CAGAGCAAGCAAGTCTGGAGTGG - Intergenic
959995237 3:112673502-112673524 CAGAGAGAACAATCCTGGAGGGG + Intergenic
960426937 3:117520374-117520396 CAGCTAAAGCAGTCCTGGAGTGG + Intergenic
961028956 3:123585316-123585338 CAGAAGCAGCGGGCCTGGAGAGG - Intergenic
962894717 3:139704120-139704142 CAGCAATAGAAGGACTGGAGAGG - Intergenic
965599700 3:170442636-170442658 CAGAGACAGCAAGAATGGAGAGG - Intronic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968515840 4:1015313-1015335 CAGGGAGTGCAGCCCTGGAGGGG - Intronic
969512943 4:7629993-7630015 CAGAGGTAGGAGAACTGGAGGGG - Intronic
970297306 4:14644015-14644037 CAGGGATAGCCGGCTTGGTGGGG + Intergenic
971240865 4:24887664-24887686 CAGAGGTTCCAGGCATGGAGGGG - Intronic
971322742 4:25618463-25618485 CAGTGGTACCAGGCCTGGGGAGG + Intergenic
971455753 4:26842209-26842231 AAGATACAGCAGGTCTGGAGAGG - Intergenic
973651589 4:53002341-53002363 TAGACTTAGAAGGCCTGGAGAGG + Intronic
975151060 4:71021363-71021385 TAGAAATAGCAGGCCGGGCGCGG - Intronic
975497103 4:75046920-75046942 CAGAGACAGGTGGCCTGGAGGGG - Exonic
975537793 4:75470419-75470441 CAGGGACAGAAGGCCTTGAGTGG - Intergenic
976323727 4:83747507-83747529 AAGAGATACCAGGGCTGCAGAGG + Intergenic
976737087 4:88321102-88321124 CAGAGATAGGAAGCCAGAAGAGG + Intergenic
980433887 4:132743296-132743318 TAGGGATAGCATACCTGGAGAGG - Intergenic
980851407 4:138387645-138387667 CAGTGATAACAGGAGTGGAGGGG - Intergenic
981429430 4:144643374-144643396 CATAGGTGGCAGTCCTGGAGAGG + Intergenic
981481440 4:145243179-145243201 CAGAGATACCCTGCCTGGAGAGG + Intergenic
984680720 4:182606231-182606253 AAGAGGTAGCAGGCCGGGCGTGG + Intronic
985923615 5:2998858-2998880 CAGAGACAGCAGGAGGGGAGAGG + Intergenic
986648374 5:9940398-9940420 CAGAGAACACAGACCTGGAGAGG + Intergenic
987770646 5:22299266-22299288 GAGAGATAGCAGGAGTGGAATGG + Intronic
990176551 5:53114518-53114540 CAGAGATGGCAGGACTTCAGGGG - Intergenic
990897564 5:60715599-60715621 CAGAGATAGCCTGCCCAGAGAGG + Intergenic
992181818 5:74205013-74205035 CAGAGAGAGCAGGGTTGGGGTGG - Intergenic
994002000 5:94791820-94791842 CAAAGATAGTGGGTCTGGAGAGG - Intronic
994991282 5:106999941-106999963 CAGAGATAGCCTGCCCAGAGAGG + Intergenic
995205094 5:109470502-109470524 CAGAGATCACATGGCTGGAGAGG - Intergenic
995603695 5:113827561-113827583 CACAGATAACAGCCCTGAAGTGG + Intergenic
995862871 5:116660693-116660715 CAGTGGTAGCTGGTCTGGAGAGG + Intergenic
996091834 5:119358997-119359019 GTGAAATAGCAGGCCTGGTGAGG - Intronic
996126554 5:119731999-119732021 CCGTGAGAGCAGGGCTGGAGGGG + Intergenic
996711669 5:126549113-126549135 CAGAGAGAGCAGGCATGGGTTGG + Intronic
996714857 5:126579027-126579049 CAGAGATGGGAGGGCTGGAGAGG - Intronic
997263136 5:132478810-132478832 CAGAGGAAGGAGGCCTGGGGTGG - Intergenic
997383534 5:133454822-133454844 CAGAAATTGCAGGCCTGGTCTGG - Intronic
997412699 5:133702448-133702470 CAGTGTGAACAGGCCTGGAGGGG - Intergenic
998168174 5:139856276-139856298 CAGAGATAGCAGGCCTGGAGGGG - Intronic
998624975 5:143836099-143836121 CAGACATTGCAGGCATAGAGTGG + Intergenic
999413840 5:151377635-151377657 AAGAGACAGCAGGCCGGGCGCGG - Intergenic
1000092621 5:157943085-157943107 CAGAGATAGAAGCCCTGGTAGGG + Intergenic
1000502504 5:162068684-162068706 CAGGGACAGCAGTCCTGGTGAGG + Intronic
1001631599 5:173179491-173179513 CAGAGATAGCAGGGCAGGAATGG - Intergenic
1002421747 5:179152610-179152632 CAGAGAGGGCAGGCCTGTGGGGG - Intronic
1002535911 5:179875269-179875291 CACAGCTGGCAGGGCTGGAGTGG - Intronic
1003183781 6:3813360-3813382 CTGAAATAGCAGCCCTGGGGTGG + Intergenic
1005358191 6:25005156-25005178 CAGAGCTAACAGGATTGGAGTGG + Intronic
1006284158 6:33080481-33080503 GTGAGAAAACAGGCCTGGAGAGG + Intronic
1008229137 6:48962254-48962276 CAGAGATGCCAGGCCTGGAAAGG + Intergenic
1008769221 6:54959257-54959279 AACAGATAGCAGGCCCGGCGCGG + Intergenic
1013390274 6:109679408-109679430 CAGAGATACCCTGCCTAGAGAGG - Intronic
1016542189 6:145178402-145178424 CAGAGATACCCTGCCTGGAGAGG - Intergenic
1019137591 6:169920897-169920919 CAGGTAGTGCAGGCCTGGAGCGG - Intergenic
1019139646 6:169935403-169935425 TTGAGCTAGGAGGCCTGGAGGGG + Intergenic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019571184 7:1713151-1713173 CAGAGATTTCATGCCTGGCGAGG - Intronic
1020144499 7:5632266-5632288 CAGAGACTGCAGCCCTCGAGGGG - Intronic
1020258308 7:6515169-6515191 CACACAGAGCAGGCCTGGCGTGG + Intronic
1021316817 7:19157900-19157922 CAGGGATAGCAGGCAGGAAGAGG + Intergenic
1021777194 7:24065470-24065492 CAGATATTGCATCCCTGGAGAGG - Intergenic
1021782282 7:24118008-24118030 CAGAGATACCCTGCCTAGAGAGG + Intergenic
1023737538 7:43248198-43248220 CAGAGATCGCAGGGCTGAGGTGG + Intronic
1024023529 7:45391814-45391836 CAGGAATGGCAGGCCTGGACGGG - Intergenic
1024190477 7:47002137-47002159 CTGAGACAGCAAGGCTGGAGGGG - Intergenic
1026082677 7:67235988-67236010 CAGAGCCAGCAGGCTTGGTGGGG + Intronic
1026399664 7:69996859-69996881 CAGATTTAGTAGGTCTGGAGTGG - Intronic
1026694388 7:72578022-72578044 CAGAGCCAGCAGGCTTGGTGGGG - Intronic
1026833209 7:73622689-73622711 CAGAGATAGCTGGGGTAGAGAGG - Intronic
1027131856 7:75596861-75596883 CAGAGAGGCCAGGCCTGCAGCGG - Intronic
1029470906 7:100753415-100753437 GAGGGATGGCAGGGCTGGAGTGG + Intronic
1029594035 7:101527259-101527281 GAGAGAGAGCAGGCCAGGTGGGG - Intronic
1032419241 7:131764661-131764683 CAGAAGGAACAGGCCTGGAGAGG + Intergenic
1032442645 7:131953747-131953769 CAGAGATAGGATGCCAGGAAAGG - Intergenic
1033798223 7:144872579-144872601 AATAGATAGGATGCCTGGAGGGG + Intergenic
1034409776 7:150934269-150934291 CATAAAGAACAGGCCTGGAGCGG + Intergenic
1036475110 8:9086121-9086143 CAGGGATAGCGGGCCAGGTGTGG + Intronic
1037135351 8:15453742-15453764 CAGACAGAGCAGGGCGGGAGAGG + Intronic
1037769634 8:21790737-21790759 CAGGGAGGGCAGGCCTGAAGGGG - Intronic
1037930730 8:22878581-22878603 CAGAGGTGCCAGGCCCGGAGAGG - Intronic
1037948950 8:23006597-23006619 CAGACAGAGCAGGGCAGGAGTGG + Intronic
1039582031 8:38674919-38674941 CAGATTTAGCAGGCAGGGAGTGG - Intergenic
1039842883 8:41306564-41306586 CAGGGATTGCAGTCCTGGGGAGG + Intronic
1039850965 8:41364609-41364631 CAGAGATCTCAGGGCAGGAGAGG - Intergenic
1040103849 8:43528108-43528130 CAGAGTTTGCAGGACTAGAGTGG + Intergenic
1041158016 8:55007622-55007644 CAGAGAGAGCAAGAGTGGAGAGG - Intergenic
1041698480 8:60762350-60762372 CAGAGACAGCAAGACTGGTGTGG - Intronic
1042070129 8:64923974-64923996 CCCAGATACCATGCCTGGAGAGG - Intergenic
1043332432 8:79133940-79133962 TAGAGAAAGCAGGCCAGGTGTGG + Intergenic
1043575250 8:81649163-81649185 CAGAGAGAGCAGGAATGGAAGGG + Intergenic
1043701358 8:83291966-83291988 CAGAGATGGCAGGACTTCAGGGG - Intergenic
1044684386 8:94812909-94812931 CAGAGACAGGAGGTCAGGAGAGG + Intergenic
1045476383 8:102556352-102556374 CAGAGCTAGCAGGTCTAGGGTGG - Intronic
1046617545 8:116494220-116494242 CAGAGGTTTCAGGCCTGGAAAGG + Intergenic
1048260836 8:132943786-132943808 CAGAGACAACAGGCCTTCAGAGG - Intronic
1048665939 8:136661560-136661582 AAGAAATAGCAGGCCGGGCGCGG + Intergenic
1050852086 9:10300721-10300743 CAGAGATACCCTGCCTAGAGAGG - Intronic
1051165536 9:14258412-14258434 CTGGGAGAGCAGGCCTGGAAAGG - Intronic
1052593664 9:30531293-30531315 CAGAGATAGCTGGACTTCAGGGG - Intergenic
1053109433 9:35444859-35444881 TAGAGACAGCAGACCTGGATGGG + Intergenic
1055356962 9:75447496-75447518 CTGTGAAAGCAGGCCTGAAGTGG + Intergenic
1056155933 9:83837785-83837807 CAGAGAAGGCAGGCATGGAAAGG - Intronic
1056354602 9:85785779-85785801 CAGAGAAGGCAGGCATGGAAAGG + Intergenic
1056427119 9:86488495-86488517 CAGAGATAGCTGGACTTCAGGGG + Intergenic
1056445733 9:86664926-86664948 GAGAGGCAGCAGGCCTGGAATGG + Intergenic
1056598980 9:88031219-88031241 AAGAGATAACAGGCCAGGCGTGG - Intergenic
1057541476 9:95976376-95976398 CACAGTAAGAAGGCCTGGAGGGG - Intronic
1057833623 9:98426705-98426727 AAGTGTTAGCAGGCCAGGAGTGG + Intronic
1058554747 9:106155026-106155048 CATAGAGAGCAGGCCAAGAGAGG - Intergenic
1058679332 9:107427548-107427570 GAGACATATCTGGCCTGGAGAGG + Intergenic
1059329568 9:113526336-113526358 CAGTGATAGCAGTGCTGGGGTGG + Intronic
1059430428 9:114246714-114246736 CAGATGTTGCAGGCCTGGTGAGG - Intronic
1060529025 9:124337098-124337120 CTGATTTAGCAGGTCTGGAGTGG - Intronic
1061560179 9:131397022-131397044 CACAGCTAGGAGGTCTGGAGGGG - Intronic
1061681333 9:132243845-132243867 CAGAGAGAGGAGGCCAGGAGGGG - Exonic
1062103918 9:134742391-134742413 CCGAGATGGGAGGTCTGGAGCGG + Intronic
1062706189 9:137944770-137944792 AAGGGGTAGCAGGGCTGGAGGGG + Intronic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1186415461 X:9379844-9379866 CAGGGAAAGCAGCCCTGCAGAGG - Intergenic
1187368515 X:18684450-18684472 TATAGATAGCTGGTCTGGAGAGG - Intronic
1187712511 X:22068252-22068274 CAGAGGTAGGAGGCCTGGTGAGG - Intronic
1189446502 X:41085693-41085715 CAAAGCCACCAGGCCTGGAGCGG + Exonic
1189617897 X:42803052-42803074 CTGACACAGCAGGTCTGGAGTGG + Intergenic
1190296495 X:49030536-49030558 CAAGGAAAGCAGCCCTGGAGTGG + Exonic
1190958667 X:55222907-55222929 CAGAGATAGAAGGCCAGGTGTGG + Intronic
1190964274 X:55283006-55283028 CAGAGATAGAGGGCCAGGTGTGG + Intronic
1192822076 X:74656466-74656488 CAGTGACAGCAGGGCTAGAGAGG + Intergenic
1193492510 X:82166516-82166538 CAGTGATAGCATGGCTAGAGGGG - Intergenic
1194139886 X:90196415-90196437 CAGAGATGCCCTGCCTGGAGAGG - Intergenic
1195001049 X:100643751-100643773 GAGGGAAAGCATGCCTGGAGAGG - Intergenic
1195470140 X:105220744-105220766 CAGAGATACCAGGAGTGGAAGGG + Intronic
1197976444 X:132170924-132170946 CAGAAGTAGCAGGGCTTGAGTGG + Intergenic
1198062316 X:133059124-133059146 CAGAGATGGCAGAAATGGAGGGG - Intronic
1198321202 X:135520819-135520841 CAGAAAGAGGAGGCCAGGAGCGG + Exonic
1199051319 X:143240087-143240109 CAGACAGTGCAGCCCTGGAGTGG + Intergenic
1199680499 X:150221243-150221265 CAGAGAGAGGAGGGCTGCAGAGG - Intergenic
1201488587 Y:14517478-14517500 CAGAAATAGCAGGCTTGTGGTGG - Intergenic