ID: 998169494

View in Genome Browser
Species Human (GRCh38)
Location 5:139864149-139864171
Sequence CCTAGCCTGCTCTGCAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998169485_998169494 11 Left 998169485 5:139864115-139864137 CCTGGAGAAGAGGAGGTCGGGGG 0: 1
1: 0
2: 0
3: 26
4: 347
Right 998169494 5:139864149-139864171 CCTAGCCTGCTCTGCAGGATGGG 0: 1
1: 0
2: 1
3: 13
4: 152
998169476_998169494 24 Left 998169476 5:139864102-139864124 CCCAGCTGTCCTCCCTGGAGAAG 0: 1
1: 0
2: 1
3: 30
4: 279
Right 998169494 5:139864149-139864171 CCTAGCCTGCTCTGCAGGATGGG 0: 1
1: 0
2: 1
3: 13
4: 152
998169477_998169494 23 Left 998169477 5:139864103-139864125 CCAGCTGTCCTCCCTGGAGAAGA 0: 1
1: 0
2: 2
3: 31
4: 260
Right 998169494 5:139864149-139864171 CCTAGCCTGCTCTGCAGGATGGG 0: 1
1: 0
2: 1
3: 13
4: 152
998169483_998169494 12 Left 998169483 5:139864114-139864136 CCCTGGAGAAGAGGAGGTCGGGG 0: 1
1: 0
2: 1
3: 24
4: 389
Right 998169494 5:139864149-139864171 CCTAGCCTGCTCTGCAGGATGGG 0: 1
1: 0
2: 1
3: 13
4: 152
998169480_998169494 15 Left 998169480 5:139864111-139864133 CCTCCCTGGAGAAGAGGAGGTCG 0: 1
1: 0
2: 1
3: 20
4: 180
Right 998169494 5:139864149-139864171 CCTAGCCTGCTCTGCAGGATGGG 0: 1
1: 0
2: 1
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998169494 Original CRISPR CCTAGCCTGCTCTGCAGGAT GGG Intronic
900373872 1:2344501-2344523 CCTGGCCTCCTCAGCAGCATCGG - Intronic
901633834 1:10660531-10660553 CCCATCCTCCTCTGCAGGAGAGG - Exonic
902583645 1:17425038-17425060 CCAAGTCTGGTCTGCAGGCTTGG - Intronic
903034299 1:20484797-20484819 CCTAGCCTTCCCCGCAGGAATGG + Intronic
903663166 1:24991053-24991075 GCTACCCAGCTCTGCAGAATAGG + Intergenic
904599869 1:31667432-31667454 CCCAGCCTGTGCTGCAGGCTTGG + Intronic
905795953 1:40816782-40816804 CCTGGCCTCATCTGCAGAATTGG - Intronic
906383355 1:45346834-45346856 CCTAGCCTGCTCAGTAGAAGTGG + Intronic
911501815 1:98695545-98695567 CCTGGCTTGCTAAGCAGGATGGG + Exonic
911949535 1:104154767-104154789 CCTTTCCTGCTCTGGAGGCTTGG - Intergenic
916405429 1:164493360-164493382 GCTAGACTGTTCTGCAGGAGAGG + Intergenic
918370350 1:183854759-183854781 CCTTACTTGCTCTGCAGTATTGG + Intronic
920569120 1:207002968-207002990 CTTAGCCTGCACTTCAGAATGGG + Intergenic
920793453 1:209114926-209114948 CCAAGCCTGGTCTGCTGGGTGGG + Intergenic
923539498 1:234877851-234877873 CTAAGCCAGGTCTGCAGGATGGG + Intergenic
924622176 1:245671918-245671940 CCCTGCCCGCTCTGCAGGCTCGG - Intronic
1064605332 10:17033167-17033189 CCCACCCTGCTCTGCAGGCCAGG + Intronic
1069951859 10:72024524-72024546 CCAAGCCTTCTCTGCAGAAAAGG - Intergenic
1070669475 10:78367981-78368003 CCTGGCATGCTCTGCAGAAGGGG + Intergenic
1071059073 10:81548535-81548557 CCTATCCTGCCCTGCAGGGCAGG + Intergenic
1071978476 10:90978853-90978875 CCTGGCCTGCTCAGGAGGCTAGG + Intergenic
1075715151 10:124551439-124551461 CGCTGCCTGCTCTGCAGGGTGGG + Intronic
1075855329 10:125624940-125624962 CCTGGCCTCCTCTGCAGTTTTGG - Intronic
1078135716 11:8650009-8650031 CCCAGACAGCTCTGCAGAATAGG - Intronic
1078442480 11:11379003-11379025 CCTAGCATGCTTTGCACTATTGG + Intronic
1080844031 11:36010722-36010744 CCCAGGCTGCTTTGCAGGTTGGG - Intronic
1081692634 11:45088564-45088586 CCTTGCAGGCTCTGCAGGCTGGG - Intergenic
1084358299 11:68653584-68653606 CCTACCCAGCTCTGCAGGCCAGG + Intergenic
1088899562 11:114104980-114105002 GCTGGCCTGCTCTGCAAAATGGG - Intronic
1089006925 11:115099810-115099832 TCTAGCCTGCTCTGCAAATTTGG - Intergenic
1089338860 11:117744374-117744396 CCCACCCTGCCCTGCAGGACTGG - Intronic
1089384104 11:118056783-118056805 GCTTGCCTTCTCTGCAGAATTGG - Intergenic
1097937842 12:65273349-65273371 CCTAACCTGGCCTCCAGGATGGG + Intergenic
1099693457 12:85991379-85991401 CCCAGTCTGGTCTGCAGGACTGG + Intronic
1101311140 12:103580381-103580403 TCTGGCCCTCTCTGCAGGATGGG + Intergenic
1103304890 12:119956201-119956223 AGTAACCTGCTGTGCAGGATTGG - Intergenic
1104822458 12:131685175-131685197 CCTTTCCTGCTCTGTAGAATGGG + Intergenic
1104822570 12:131686403-131686425 CGTTTCCTGCTCTGCAGAATGGG + Intergenic
1104822574 12:131686439-131686461 CGTTTCCTGCTCTGCAGAATGGG + Intergenic
1104822583 12:131686511-131686533 CATTTCCTGCTCTGCAGAATGGG + Intergenic
1104822620 12:131686876-131686898 CGTTTCCTGCTCTGCAGAATGGG + Intergenic
1105706576 13:22971153-22971175 CCAAGCCTGATCTCCAGGACTGG - Intergenic
1107188613 13:37552073-37552095 CCTAGGCTGCAGTGCAGGAATGG + Intergenic
1107800968 13:44107690-44107712 CTGAGCCTGCTGTGCAGCATGGG - Intergenic
1113904900 13:113814742-113814764 CCCAGCCTCCTCTGCAGGGATGG + Exonic
1114298879 14:21356049-21356071 CCTAGCCTGCTATGCAGGGAGGG + Intronic
1118817544 14:69323761-69323783 CCTGGTCTGCTCTGCAGGGCAGG + Intronic
1119250965 14:73153592-73153614 CTAAGCCTGCTCTGTAGGACAGG - Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1124706920 15:31974186-31974208 CCAAGCCTGCCCTCCAGGCTAGG - Intergenic
1127104148 15:55595380-55595402 CCTTGCCTGCTCTGCAAAAATGG - Intergenic
1127785316 15:62350460-62350482 CCCAGCCTCATCTGCAGGAGAGG + Intergenic
1128130899 15:65226426-65226448 CCTAGCCTGCCCAGCAGAAGGGG - Intergenic
1129230597 15:74195124-74195146 GCTTGGCTGCTCTGCAGGAGAGG - Intronic
1132759035 16:1500099-1500121 CCCAGCAGGCTCTGCAGCATGGG - Exonic
1133730411 16:8573691-8573713 CTTAGCCTGCACTGAAGGATAGG - Intronic
1136289896 16:29265239-29265261 CCCAGCCTTCTCTGCAGGGAAGG + Intergenic
1138118162 16:54376874-54376896 CCTACCCTGCTGTGCAGCCTTGG + Intergenic
1141188897 16:81809255-81809277 GCTAGCCTGTGGTGCAGGATAGG + Intronic
1141921454 16:87138419-87138441 CTTACCCTGCTCTGGAGGCTGGG + Intronic
1142095782 16:88238715-88238737 CCCAGCCTTCTCTGCAGGGAAGG + Intergenic
1142823040 17:2487173-2487195 TCTAGCTTGCTCAACAGGATAGG + Intronic
1143510850 17:7394366-7394388 CACAGCCTCCTCCGCAGGATGGG - Exonic
1143573590 17:7776649-7776671 CCCAATCTGCTCTGAAGGATGGG - Intronic
1144184673 17:12785837-12785859 CCTAGCCTTCACTCCAGGAGTGG + Intergenic
1144853815 17:18257488-18257510 GCTGGCCTGCCCTGCAGGGTGGG - Intronic
1146265895 17:31452533-31452555 CCTAGCCTGCTCATCAGCAATGG + Intronic
1150868012 17:68875259-68875281 CCCAGGCTGCTCGGCAGGAAAGG - Exonic
1150877224 17:68983708-68983730 CCCAGGCTGCTCAGCAGGAAAGG - Exonic
1152364728 17:79849098-79849120 CCTAGTCTGCTCTGGAGGGTGGG - Intergenic
1152786438 17:82250398-82250420 CCTAGCCTGCTCTGAGGGCCGGG + Intronic
1157600838 18:48892298-48892320 CCCAGCCTGCCCTCCACGATGGG - Intergenic
1159536019 18:69716115-69716137 CTTAGCCTGCTTAGCACGATTGG - Intronic
1159953838 18:74505879-74505901 CCTATTCTGCTCGGCAGGCTGGG + Exonic
1159962066 18:74563056-74563078 CCAGGTCTGCTCTGCAGGACAGG - Intronic
1160438014 18:78866390-78866412 TCTAGCCAGCACTGCAGGTTCGG - Intergenic
1160438038 18:78866515-78866537 TCTAGCCAGCACTGCAGGTTCGG - Intergenic
1160438047 18:78866557-78866579 TCTAGCCAGCACTGCAGGTTCGG - Intergenic
1160438065 18:78866641-78866663 TCTAGCCAGCACTGCAGGTTCGG - Intergenic
1160438074 18:78866683-78866705 TCTAGCCAGCACTGCAGGTTCGG - Intergenic
1160438083 18:78866725-78866747 TCTAGCCAGCACTGCAGGTTCGG - Intergenic
1160968336 19:1756243-1756265 CCTTGCTTGCTCTGCAGAAGGGG - Intronic
1161327928 19:3672358-3672380 ACCAGGCTGGTCTGCAGGATGGG - Intronic
1162344526 19:10111592-10111614 GCTGGCCTGCTCTGCTGGCTGGG + Exonic
1163630392 19:18415380-18415402 CCCGGCCTCCTCTGCAGGAATGG + Intergenic
1165006806 19:32814192-32814214 CCACGGCTGCTCTGCAGGATGGG - Intronic
1165716951 19:38052556-38052578 CCTAGCCTGCTCTGAAACACAGG - Intronic
1168345310 19:55647919-55647941 ACTCGCCAGCTCTCCAGGATGGG + Intronic
925868334 2:8248034-8248056 CCTGGCCTGCACAGCAGGAGAGG - Intergenic
928403162 2:30993841-30993863 CCTTGCCTCCTCTGCTGGAGGGG - Intronic
929397540 2:41540560-41540582 CGTAGCCTGCTTTCCAGGCTGGG + Intergenic
936792732 2:116168671-116168693 CCTAGCTTGCTGTGCAGGGGTGG + Intergenic
937234552 2:120422860-120422882 CCCAGCCTGCCCTCCAGCATGGG + Intergenic
942150707 2:173073989-173074011 GCTAGAGTGCTTTGCAGGATAGG - Intergenic
944780851 2:203015120-203015142 CCCAGCCTGCACTACAGTATCGG - Intronic
945293522 2:208147995-208148017 CCTAGCCTTCCCTGCGGGATGGG - Intergenic
946321996 2:218959803-218959825 CCGGCCCCGCTCTGCAGGATGGG + Exonic
946507322 2:220315628-220315650 TCTAGCCAGCTGTGCAGGGTTGG - Intergenic
947592154 2:231391954-231391976 CCTGCACTGCCCTGCAGGATGGG + Intergenic
948273026 2:236688367-236688389 TCTGGCCTGTTCTGCAGGATGGG + Intergenic
948988920 2:241541977-241541999 CCAAGCCTGCTCTGCAGAGGGGG - Intergenic
1169354466 20:4895876-4895898 CCAACCTTGCTCTGCTGGATGGG + Intronic
1170634408 20:18092286-18092308 CCTAGCTTGCTCTTAAGGAAGGG - Intergenic
1171402075 20:24880179-24880201 CCCAGCCTCCTCAGCAGGGTGGG - Intergenic
1171407025 20:24918350-24918372 CCTAGCCTGCTCCGCAGCGGCGG - Intergenic
1175392173 20:58634424-58634446 CTTTTCCTGCTCTGCTGGATGGG - Intergenic
1176232514 20:64039454-64039476 CCCAGCCCCCTCTGCAGGACTGG + Intronic
1177678368 21:24332589-24332611 CCAGGCCTGACCTGCAGGATGGG + Intergenic
1181647015 22:24236951-24236973 CTCAGCCTCCTCTTCAGGATTGG - Intronic
1183063166 22:35347650-35347672 CCTTCCCTGCTCTGCTGCATGGG + Exonic
1183301193 22:37059972-37059994 CCTTGGCTGCTCTGCAGGATAGG + Intronic
1183831513 22:40420640-40420662 CCAAGCCTGGGCAGCAGGATTGG + Intronic
1183911362 22:41081922-41081944 CCTTCCCTGCTGTGCAGGAAAGG + Intergenic
1184555841 22:45232751-45232773 CCCAGCCCACTCTGCAGGATGGG - Intronic
1184860132 22:47168889-47168911 CCTCGCCTGCTCTTCAGCATCGG + Intronic
1184987788 22:48147159-48147181 CCCCGCCCGTTCTGCAGGATGGG + Intergenic
950863131 3:16168309-16168331 TCTGGCCTGCTCTGCATGAACGG + Intergenic
950880153 3:16316879-16316901 CCTGGCATCCTCTCCAGGATTGG + Exonic
953410736 3:42689230-42689252 GCCAGCCTGGTCTGCAGGAGGGG + Intronic
953910142 3:46888700-46888722 CATCGCCTGCTCAGCAGAATGGG - Intronic
954361057 3:50123069-50123091 CCCAGCCTGTCCTGCAGGGTTGG + Intergenic
958142814 3:89585209-89585231 CCCAGTCTGCTCTGCATGTTAGG - Intergenic
959999055 3:112711854-112711876 CCTCGCCAGTTCTGTAGGATAGG - Intergenic
960086095 3:113593162-113593184 GCTAGACTACTCTGCGGGATAGG - Intronic
961098183 3:124175479-124175501 CCAGGCCTGATCTCCAGGATGGG + Intronic
961098209 3:124175611-124175633 CCAGGCCTGATCTCCAGGATGGG + Intronic
961938400 3:130610870-130610892 GATAGCCTGCTCTGCAAGATGGG - Intronic
968664107 4:1811264-1811286 CGCTTCCTGCTCTGCAGGATGGG - Intergenic
968960911 4:3743203-3743225 CCCAGTCTGCCTTGCAGGATGGG - Intergenic
972559843 4:40217007-40217029 TCTAGCATGCTGAGCAGGATGGG + Intronic
980017394 4:127666631-127666653 CCTAACTTGCTCTGCAGTAATGG + Intronic
981322745 4:143411541-143411563 CTGCTCCTGCTCTGCAGGATTGG + Intronic
985659851 5:1151669-1151691 CTGAGCCTGCTCTAGAGGATGGG - Intergenic
987128007 5:14833425-14833447 CCTAACAAGCTCTGCAGGGTAGG - Intronic
994042907 5:95277628-95277650 CCTCGCCAGCTCTGCTGGAGTGG - Intronic
996817879 5:127593877-127593899 CTTAGCCTGCCCTGCAGATTGGG - Intergenic
997528014 5:134565961-134565983 CCCAACCTCCTGTGCAGGATGGG - Intronic
997750657 5:136342285-136342307 CTTGGCCAGCTCTCCAGGATGGG - Intronic
998169494 5:139864149-139864171 CCTAGCCTGCTCTGCAGGATGGG + Intronic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
999845499 5:155475120-155475142 CCTGGCCTGCTGTGAAAGATGGG + Intergenic
1000251113 5:159496742-159496764 CCTGGCCTGCCCTACAGGTTTGG + Intergenic
1001305418 5:170568969-170568991 CCCAGCCTCCTCTGCTGGATCGG + Intronic
1001476442 5:172054316-172054338 CCATTCCTGCTGTGCAGGATTGG - Intronic
1007329491 6:41093847-41093869 CCTAGCCTTATCTGCATGTTAGG - Intronic
1008654936 6:53602218-53602240 TCTAGCCTGCTTGGCAGGAGAGG - Intronic
1012987719 6:105892824-105892846 CTTATCCAGCTCTGCAGGAGTGG - Intergenic
1018786185 6:167109810-167109832 CCTGGCATGCTCCGCAGGATGGG - Intergenic
1022098085 7:27153072-27153094 CCTCGCCTGGTCTGCAGGCGGGG + Intergenic
1024566318 7:50684006-50684028 CCTGCCATGTTCTGCAGGATTGG - Intronic
1027053795 7:75036448-75036470 CCTTGGCTGCTCTGCAGGGCAGG + Intronic
1030697039 7:112597023-112597045 CTTAGCTTGCCCTGAAGGATTGG - Intergenic
1032804207 7:135339375-135339397 CCCAGCCTCCCCTGCAGGGTGGG + Intergenic
1033791273 7:144795261-144795283 CCTAGCCAGCTCTGCAAGAGTGG + Intronic
1035765346 8:2100708-2100730 CTTACCCTGCTCTGCAAGAGAGG + Intronic
1037725129 8:21477092-21477114 CCAATCCTCCTCTGCAGGTTGGG - Intergenic
1039139549 8:34370704-34370726 TCTAGCCTGTTCTTCAGCATTGG - Intergenic
1039334292 8:36573061-36573083 CATAGCTTACTCAGCAGGATTGG - Intergenic
1048302248 8:133260273-133260295 CCTACCCTGCTCTGCTGTCTCGG + Intronic
1049781295 8:144430146-144430168 CATAGTCTGCTCTGAAGGTTGGG + Intronic
1051252956 9:15180714-15180736 TCTTCCCTGCTCTGAAGGATAGG + Intronic
1052609964 9:30759186-30759208 CCTCGCCTACCCTGCAGGCTTGG - Intergenic
1053353748 9:37430033-37430055 CCTGGACTGCTCTGCTGGCTCGG - Intronic
1060526519 9:124324086-124324108 CCGAGCCAGCTCTGCAGGTGAGG - Intronic
1186909295 X:14144266-14144288 CCTCCCCTGCTCTGGAGGATGGG - Intergenic
1195906744 X:109851672-109851694 CCTAGTCTGCAAAGCAGGATTGG + Intergenic
1199967858 X:152834692-152834714 CTTGGCCTCCTCTGCAGGACTGG - Intronic