ID: 998173767

View in Genome Browser
Species Human (GRCh38)
Location 5:139887595-139887617
Sequence CTTTGGGCTGGAACTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998173757_998173767 11 Left 998173757 5:139887561-139887583 CCAAGCATGAGTAGTGGAGAGTA 0: 1
1: 0
2: 1
3: 10
4: 80
Right 998173767 5:139887595-139887617 CTTTGGGCTGGAACTGGGGAAGG 0: 1
1: 0
2: 4
3: 50
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998173767 Original CRISPR CTTTGGGCTGGAACTGGGGA AGG Intronic
900116526 1:1031556-1031578 CCTTGGGCTGGGCCAGGGGAAGG - Intronic
900117531 1:1034907-1034929 CTTTCTGCGGGAGCTGGGGAGGG + Intronic
900316634 1:2060368-2060390 TGTTGGGCGGGAACTGGGGGTGG + Intronic
900793231 1:4692878-4692900 CTCTGTGCTGGAACTGGACAGGG + Intronic
900929350 1:5726508-5726530 CTTTGGGCTGGACCCGTGGTGGG - Intergenic
900929410 1:5726776-5726798 CTTTGGGCTGGACCTGTGGTGGG + Intergenic
901064388 1:6488007-6488029 CTTCGGTCTGGCAGTGGGGAAGG - Intronic
901838773 1:11940676-11940698 CTTTGGGCAGTAGGTGGGGAGGG + Intronic
902597779 1:17520894-17520916 ATTGGTGCTGGAACTGGGGTTGG + Intergenic
902990999 1:20186787-20186809 GTTTGGGGTAGAACTGGGAATGG + Intronic
903292814 1:22325603-22325625 CTTCTGGCTGGGGCTGGGGAGGG - Intergenic
903566007 1:24266361-24266383 CCTTGGGCTGTCCCTGGGGAAGG - Intergenic
904419272 1:30381152-30381174 CTTTGGGTTGAGACTGGGGGCGG - Intergenic
904746304 1:32713324-32713346 CTTGGGCCTGCACCTGGGGACGG - Intergenic
905174244 1:36125978-36126000 CTTTGGGCTAGGCCTGGGGGCGG + Intergenic
905542469 1:38771355-38771377 ATGTGGGCTGGAGCTGGGCATGG + Intergenic
905726634 1:40258017-40258039 CTTTGGGCCGGAAGTGAGGAAGG + Intergenic
905890298 1:41514643-41514665 CTATGGGGTGGAGCTGGGGCTGG - Intronic
905890408 1:41515342-41515364 CTATGGGGTGGAGCTGGGGCTGG + Intronic
906202360 1:43968211-43968233 CTTTGGGCTGCAAGTGGGGTAGG + Intergenic
906561722 1:46763118-46763140 CTTTGGACTGGGACTGGGACTGG + Intronic
908714270 1:67053682-67053704 AGTTGGGCGGGAGCTGGGGAGGG - Intronic
911381315 1:97118506-97118528 CATGGGGCAGGAACTGAGGAGGG + Intronic
912924856 1:113905043-113905065 ATTAAGGCTGGAACTGGAGAGGG - Intronic
914760792 1:150596428-150596450 CATTGATCTAGAACTGGGGAGGG + Intergenic
916300583 1:163269237-163269259 AATTGGGCTGGAACTAGAGAAGG + Intronic
917167660 1:172130781-172130803 CAGTAGGCTGGAAGTGGGGAAGG + Intronic
917660068 1:177169772-177169794 CTGGGGGCTGGAGCTGGGGAAGG - Intergenic
918020117 1:180679281-180679303 ATTTGTGCTGGTTCTGGGGAGGG + Intronic
919503427 1:198367601-198367623 CTTTGAGCTGGAACTGAAAAAGG - Intergenic
919750001 1:201031638-201031660 CCTTGGCCTGGAAAAGGGGAAGG + Intergenic
919767208 1:201135156-201135178 CTCAGGGCTGGAGCTGGGGCTGG + Exonic
922915151 1:229251423-229251445 CTGTGGGCTGGGGCTGGGGCAGG + Exonic
924001706 1:239560935-239560957 CTTTTGCCTAGATCTGGGGAAGG - Intronic
924454159 1:244204790-244204812 CTTTGGTCAGTCACTGGGGAAGG + Intergenic
1062884322 10:1004873-1004895 CTTGGGACTGGAACTGCGGCTGG - Intronic
1063331026 10:5159622-5159644 CTTTGGTCTGGAGCTCGGGATGG - Intergenic
1063559325 10:7111977-7111999 CTGAGGGTTGGAACTTGGGAAGG + Intergenic
1065145537 10:22764232-22764254 CTGTGGGATGGCACTGGGGGTGG + Intergenic
1065801243 10:29354952-29354974 CTTTGAGGAGGAACAGGGGAGGG - Intergenic
1065900981 10:30207696-30207718 CTTGGGGCTGGAACAGAGGAGGG + Intergenic
1066491033 10:35895002-35895024 CGTTGGGCTGGAGGTGGGGAAGG + Intergenic
1067061848 10:43081728-43081750 CTTGGGGCTGGAAGGGGAGAAGG + Intronic
1067234142 10:44434383-44434405 CTCTGGTCTGGTATTGGGGAGGG + Intergenic
1068774295 10:60854299-60854321 CTTAGGGCTGGGAGTGGGGATGG + Intergenic
1070567248 10:77613264-77613286 CTCTGTGCTGCAACTGGGGAAGG - Intronic
1070569166 10:77628017-77628039 CTTTGGGAGTGAACTGGGGCTGG - Intronic
1070679812 10:78440644-78440666 CTTGGGGCAGGAACTGGGACTGG - Intergenic
1070753965 10:78980283-78980305 CTTCAGGCTGGCACCGGGGAAGG + Intergenic
1070755840 10:78992793-78992815 GTTTGGGCTGGAGCTGGGCTTGG - Intergenic
1070764149 10:79047028-79047050 CTTAGGGCAGGAACACGGGAGGG - Intergenic
1070828274 10:79403740-79403762 CTTTGGGCTGGGAACGGGGGTGG - Intronic
1071287403 10:84161796-84161818 CTTTAGGCTGAAACTTGGGCTGG + Intergenic
1071464459 10:85926642-85926664 CTTTGTGCTGGCAATGGGGTGGG - Intronic
1071521609 10:86334831-86334853 CTGTGTTCTGGAAGTGGGGAGGG - Intronic
1072469382 10:95698117-95698139 ATTTGAGATGGAACTGAGGAAGG + Intergenic
1072880300 10:99220499-99220521 CTATGGAGTAGAACTGGGGATGG + Intronic
1073299717 10:102463492-102463514 CTGTGGGCTGGAGGAGGGGAAGG + Intronic
1073760780 10:106626194-106626216 CTGAGGGTAGGAACTGGGGAGGG + Intronic
1074049120 10:109866553-109866575 CTTTTGGTTGGAAGTAGGGAGGG + Intronic
1075110422 10:119576144-119576166 CTATGGGCTGGCCCTGGGCAGGG + Intronic
1075346457 10:121685619-121685641 CCTGGGGCTGGAGCTGGGGAAGG + Intergenic
1075351141 10:121726083-121726105 CTTGGGGCTGGGTCTGGAGAGGG + Intergenic
1075553240 10:123409582-123409604 AATTGGGCTGGAGTTGGGGAGGG - Intergenic
1075736075 10:124665337-124665359 AGTTGGGCTGGAACTGGGGTTGG - Intronic
1075853683 10:125609491-125609513 TCCTGGGCTGGACCTGGGGATGG - Intronic
1076338662 10:129727958-129727980 CTTCTGGCTGGAGCAGGGGAGGG + Intronic
1076428637 10:130385345-130385367 CTCTGGGCTGGATGTGTGGATGG + Intergenic
1076544789 10:131238129-131238151 CTAGGGGCTGGAACAGGGGCGGG - Intronic
1076799039 10:132812253-132812275 CTTTTGGCAGGAGGTGGGGATGG - Intronic
1077117684 11:892706-892728 GTGTGGGCTGCAACTGGGCAAGG - Intronic
1077353820 11:2105536-2105558 GCTTGGGCTGGGCCTGGGGAGGG - Intergenic
1077423908 11:2465638-2465660 CTTGGGGGTGGAATTGGAGAGGG + Intronic
1078909337 11:15716685-15716707 ATTTGGTTTGGAACTGGGGCAGG - Intergenic
1078938434 11:15973719-15973741 CCCTGGGCTGGAACTGGGGTTGG + Intronic
1080641704 11:34162267-34162289 CCCTGGGCTGTGACTGGGGAGGG + Intronic
1080737057 11:35026534-35026556 GTTTGGGCCAGAACAGGGGAAGG + Intergenic
1081858192 11:46317020-46317042 CTTGGGGCTGGGACGAGGGAGGG - Intronic
1082005316 11:47415856-47415878 CTTTGGCTTAGAAGTGGGGAAGG - Exonic
1083301953 11:61744240-61744262 GGTTGGGCTCGAACTGGGCACGG - Exonic
1083396029 11:62392661-62392683 CTGTGGGCTGGAAGGTGGGAAGG + Exonic
1083397724 11:62402749-62402771 CTTTGGGCTGGGTCTGGTGGGGG - Intergenic
1083713558 11:64563038-64563060 CCTTGGGTTGGCACTGAGGAAGG + Intronic
1083753995 11:64779156-64779178 CTTGGGGCGGGAGCAGGGGAGGG + Intergenic
1083852785 11:65377711-65377733 ATTTGGGATGGAATTGGGGCTGG + Intronic
1084166501 11:67377231-67377253 CTTTGGGGTAGAAATGTGGATGG + Intronic
1084195659 11:67522651-67522673 CTTGGGGCTGGAGCTGGGGCTGG + Exonic
1084218204 11:67662949-67662971 CAAAGGGCTGGAATTGGGGAGGG + Exonic
1084465723 11:69321840-69321862 CTGTGCGCTGGAGCTGGGGCTGG - Intronic
1085076519 11:73597392-73597414 ATTTGGGGTGGACCTGGGGCAGG - Intronic
1085197140 11:74679600-74679622 GTGTGGCCTGGAACTGGGGAAGG + Intergenic
1086305871 11:85481742-85481764 GTTTGGCCTGGTACTGGGGCAGG - Intronic
1086454462 11:86947611-86947633 CTTGGGCCTGAAACTGGAGAAGG - Exonic
1086646747 11:89231627-89231649 CTGGGGGCTGGAGCTGGGGTGGG + Intronic
1087102725 11:94380774-94380796 CTGGGGGCAGGAAGTGGGGAGGG + Intronic
1087211688 11:95451353-95451375 CCTTGGCCTGGAACTTTGGAAGG - Intergenic
1087914915 11:103799116-103799138 CTTTGGGCTGGACATTGGGATGG + Intergenic
1089131551 11:116216065-116216087 ACTTGGGCTACAACTGGGGAAGG + Intergenic
1089209054 11:116788512-116788534 CTTGAGGCTGGGATTGGGGAAGG - Intergenic
1089323831 11:117644038-117644060 CTTGGGATAGGAACTGGGGAAGG - Intronic
1089669772 11:120045802-120045824 ATTTGGGATGGAAGTAGGGAAGG - Intergenic
1089775318 11:120831746-120831768 ATGTGGGCTGGAAGTGGGGTCGG - Intronic
1090002439 11:122973865-122973887 CTTTGGGGGAGAAGTGGGGAAGG - Intergenic
1090043418 11:123310436-123310458 TCTTTGGCTGGCACTGGGGATGG - Intergenic
1090589385 11:128249074-128249096 CTTTTGGTTGGAACTTGGGTTGG + Intergenic
1091687657 12:2575056-2575078 GTCTGGCCTGGACCTGGGGATGG - Intronic
1091791581 12:3274986-3275008 CTTTGGACAGGAAATGGGAAAGG + Intronic
1096258850 12:50078660-50078682 GGGTGGGCTGGAACTGGGGTTGG - Intronic
1096621321 12:52867542-52867564 GTTTGGGGTGGAGGTGGGGAAGG - Intergenic
1096837561 12:54360794-54360816 CACTGGGGTGGCACTGGGGATGG - Intergenic
1097053819 12:56238641-56238663 CTGTGGCCTGGAGCTGGAGAAGG + Exonic
1097429223 12:59483248-59483270 CTCTGGACTGGAACTGGAGCTGG - Intergenic
1101870242 12:108559977-108559999 CTTTGGGCCGGAAGGGGTGAAGG - Intronic
1102170244 12:110836760-110836782 GTGAGGGCTGGAGCTGGGGAGGG + Intergenic
1102497031 12:113326990-113327012 TTTTGGGTGGGAGCTGGGGATGG - Intronic
1104504447 12:129318447-129318469 CTCCGGGCTGGTACTGGGGGTGG + Intronic
1107005915 13:35611576-35611598 CCTTGGGCTGGAGGTGGGCAGGG - Intronic
1109150701 13:58843919-58843941 TTCTGGGCTGGTACTGGGGAGGG - Intergenic
1110566457 13:76961936-76961958 CTATGGGCTGGAGGTGGGAATGG - Intergenic
1110714157 13:78682988-78683010 ATTTGGAGTGGAAGTGGGGAGGG + Intergenic
1110767512 13:79297840-79297862 CTTTTGACTGGAACTGGGGCAGG - Intergenic
1112161910 13:96876991-96877013 CTTTGTGCTGGAGCCTGGGAAGG - Intergenic
1112397314 13:99044926-99044948 CTATGGGCTGGAATTGTGGTGGG - Intronic
1112683844 13:101799689-101799711 CTTTGGGAAGGAAGTGGGAAGGG - Intronic
1113798498 13:113074428-113074450 CTTTGACCTGGAACAGAGGAGGG - Exonic
1114568079 14:23647043-23647065 CTCAGGGTTAGAACTGGGGAGGG + Intergenic
1115358836 14:32478744-32478766 TTTTAGGCAGGAAATGGGGATGG + Intronic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117965364 14:61202224-61202246 CTCTGGGCTGAACCTTGGGATGG - Intronic
1118094348 14:62519863-62519885 TTTTGGGCTGGAACTATGTACGG - Intergenic
1118097020 14:62547782-62547804 CATGGAGCTGGAGCTGGGGAAGG - Intergenic
1118442001 14:65820900-65820922 CTCTGGGCTTGACCTGGGAAAGG + Intergenic
1118691380 14:68343828-68343850 CTTTGAGCTGGAGCTGGAGATGG - Intronic
1119236956 14:73027403-73027425 TTTTGGGTTGTAACTGGGGAAGG + Intergenic
1119432004 14:74574684-74574706 TTTAGGGCTGGACCTGGGGCAGG + Intronic
1119519945 14:75278174-75278196 ATTAGGGCTAGAATTGGGGATGG + Intergenic
1119942961 14:78660553-78660575 CTTTGGGCTAGAACTTGGAGTGG + Intronic
1120997275 14:90426354-90426376 CTCTCTCCTGGAACTGGGGAAGG - Intergenic
1121561190 14:94877241-94877263 CTCTGGCCTGGAACTTGGGGAGG - Intergenic
1121979750 14:98444223-98444245 CTCTGGGCAGGAAGTGGGGGTGG + Intergenic
1122088273 14:99321806-99321828 CCTGGGGCCTGAACTGGGGAGGG - Intergenic
1122359885 14:101152936-101152958 GTGTGGGCTGGAACTGGGAGGGG - Intergenic
1122627055 14:103090155-103090177 CTTGGGCCTGGCACTGGGGCAGG + Intergenic
1122641866 14:103164828-103164850 TTTTGGGCTGGGGATGGGGACGG - Intergenic
1202893415 14_KI270722v1_random:181321-181343 CTTTGCTCTGGAAGTGGGGGTGG - Intergenic
1124645333 15:31434360-31434382 CATTGAGCTGGCTCTGGGGATGG + Intronic
1124806149 15:32885202-32885224 CTTTGGGTTGGAATTGGAAAGGG - Intronic
1124933773 15:34150345-34150367 CTTTGGGCTGGGGCTGAGGCAGG + Intronic
1125499619 15:40231249-40231271 CTAAGGGCTGGGGCTGGGGAGGG + Intergenic
1125956583 15:43794678-43794700 TCTTGGGCTGGAAGTGGGGGTGG - Exonic
1127600200 15:60527953-60527975 CCGTGGGCTGGAGCTGAGGAAGG - Intronic
1127905577 15:63373647-63373669 CCTTGGGCTAGACCTGGGAAAGG - Intronic
1128082776 15:64866117-64866139 CTCTGGGCTGGGGCTGGGGCTGG + Exonic
1128934321 15:71732393-71732415 CTCTCGGCTGGCACTGGGCATGG + Intronic
1129667030 15:77585006-77585028 CCTTGGGCTGGTAATGGGAAAGG - Intergenic
1130896385 15:88173552-88173574 CTACTGGCTGGCACTGGGGAGGG - Intronic
1130906045 15:88241530-88241552 CTCTGGGCTGGAAAGGAGGAGGG + Intronic
1131782495 15:95874763-95874785 CTCTGGGGTGAAACTGGGGTTGG - Intergenic
1132354631 15:101162355-101162377 CTCTGAGCTGCAACTTGGGAGGG + Intergenic
1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG + Intergenic
1132865299 16:2090182-2090204 CTTTGTGGCGGAACTGGGGGCGG + Exonic
1132977025 16:2716050-2716072 CTTTGGGGGGCAGCTGGGGAGGG - Intronic
1134850535 16:17475081-17475103 ATTTGGGGTGGAGGTGGGGAGGG - Intergenic
1136065512 16:27755587-27755609 CTATGGGCTGCCCCTGGGGAGGG + Intronic
1139528253 16:67529292-67529314 GGCTGGGCTGGAAATGGGGAGGG + Intronic
1139547726 16:67657474-67657496 CTTTGGTCTGTGGCTGGGGAGGG - Exonic
1139631675 16:68235351-68235373 CCCCGGGCGGGAACTGGGGATGG + Intronic
1140019981 16:71229725-71229747 CTATGGGCTGGAAGTGGGGAAGG + Intronic
1140225201 16:73071361-73071383 CTGTGGTCTGGCAGTGGGGAAGG - Intergenic
1141148878 16:81550829-81550851 GTGTGTGATGGAACTGGGGAGGG - Intronic
1141376741 16:83537960-83537982 ATTTGGGCCGTAACTGGGAAAGG - Intronic
1141772238 16:86096391-86096413 CCTAGGGCTGGGACTGGGGGAGG - Intergenic
1142144853 16:88488654-88488676 CTTTGGGCTGGAATCGGTGCAGG + Intronic
1142293270 16:89202123-89202145 CTTTCGGCTGGTACTGCGGGAGG + Intergenic
1142299461 16:89247853-89247875 CTTTCGGCTGGTACTGCGGGAGG + Intergenic
1142866109 17:2792556-2792578 CTGAGGGCTGGAAAGGGGGAAGG - Intronic
1142898345 17:2996421-2996443 CTCTGAGCAGGAACTGGGGAGGG + Intronic
1143203336 17:5127041-5127063 GTTTGGGGTGGGAATGGGGATGG + Intronic
1143377452 17:6475203-6475225 CTGTGGGCTGGGGCTGGGGGTGG - Intronic
1143618713 17:8069041-8069063 CATTGGGCAGAAACTGGGGAAGG - Intergenic
1143626041 17:8110591-8110613 CTCTGGGGTGGAAGTGGGCAGGG - Intronic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1144158440 17:12532762-12532784 ATTTGGGCCTCAACTGGGGAAGG + Intergenic
1144225863 17:13145349-13145371 CTCTGGTCTGAAACTGAGGATGG + Intergenic
1144574362 17:16419729-16419751 CTTGGGGCTGGATCTGGATAGGG - Intronic
1144783890 17:17821404-17821426 CTTTGGGATGGAGATGGGGATGG + Intronic
1147212185 17:38878076-38878098 CTTTATGCCAGAACTGGGGATGG - Exonic
1147302434 17:39540729-39540751 AATTGGGCTGGGACTGGGGCGGG + Intronic
1147557511 17:41488831-41488853 CTCAGGGCTGGAAATGGTGAAGG - Intronic
1147607746 17:41784063-41784085 CTTTGGGCTTGAACTGAGCTGGG - Intronic
1147723802 17:42554321-42554343 GTTGGGGCTGGGACTGGGGTTGG + Intronic
1147753137 17:42749601-42749623 TTCTGGGTTGGAACTGGGGGAGG - Intergenic
1147771105 17:42868211-42868233 CTTGGGGATGGAACTGCAGAGGG - Intergenic
1148213143 17:45820123-45820145 CTTGGGGCTGGAACAGGGCTGGG - Intronic
1150121632 17:62608333-62608355 CCTTCTACTGGAACTGGGGATGG - Intronic
1151162631 17:72178225-72178247 CTTTGGGCCTGAACTTGGTAAGG + Intergenic
1151563581 17:74884242-74884264 CTTCGGGCTGGCTCTGGGGCAGG - Intronic
1151933123 17:77245264-77245286 CTTTGGGAAGGAAATGTGGAGGG + Intergenic
1152274503 17:79348394-79348416 CTTTGGCCTGGAGCAGGGGTGGG - Intronic
1152445306 17:80339329-80339351 CTTTGGCTTGGACCTGGTGACGG + Exonic
1152601231 17:81263253-81263275 CTTTGGGCTGGGACAAGGGCGGG + Intronic
1152733947 17:81987573-81987595 CCTGGGGCTGCCACTGGGGAGGG + Intronic
1152863635 17:82709761-82709783 CCTTGGCCTGTACCTGGGGAGGG + Intergenic
1152868054 17:82735859-82735881 CCTGGGGCTGGGCCTGGGGAGGG + Intronic
1153066716 18:1053666-1053688 CTGTGGGTCAGAACTGGGGACGG + Intergenic
1154312047 18:13274317-13274339 CTCTTGGCTGGACCTGGGGAGGG + Intronic
1155329455 18:24699861-24699883 TTTTGGGGTGGGAATGGGGATGG + Intergenic
1155840379 18:30635535-30635557 CTCTGGGCAGGAACTAGGCAGGG + Intergenic
1156370909 18:36470461-36470483 ATTTGGCATGGAACTGGGGGAGG + Intronic
1157080115 18:44515435-44515457 ATGTGGGATGGAACTGGTGAGGG + Intergenic
1158623229 18:59050196-59050218 CTCTGGTCTGCACCTGGGGACGG - Intergenic
1159425844 18:68285255-68285277 TTTTGGGGGGGCACTGGGGAGGG + Intergenic
1160863108 19:1245877-1245899 CCTGGGGCTGGAACTGGGGGCGG - Intergenic
1160903865 19:1442996-1443018 CCTTGAGCTGGACCTGGGGTGGG - Intergenic
1160926055 19:1546412-1546434 CTGTGGGGTCGAAATGGGGAAGG + Intergenic
1160974755 19:1787305-1787327 GTTGGGGCTGGGACTGGGGTGGG + Intronic
1161207556 19:3049259-3049281 CTTTGTGTGGGAACTGGGGTAGG + Intergenic
1161285114 19:3464588-3464610 CTTTGGCCTGGGTCGGGGGAGGG - Intronic
1161364209 19:3868849-3868871 GTTGGGGCTGGGACTGGGGCCGG + Intronic
1161718699 19:5891840-5891862 GTCAGGGCTGGAACTGAGGAGGG - Exonic
1162241983 19:9362672-9362694 CTTTGGTCAGGAAGAGGGGAGGG + Intronic
1162484899 19:10953800-10953822 CTTTGGGCGGGAACCGGGGAGGG - Intergenic
1163307303 19:16488778-16488800 ATTTGTGCTAGAACTGGGAAGGG - Intronic
1164711466 19:30359843-30359865 CTCTGGGCTGCAACTGGACAGGG + Intronic
1165498569 19:36169319-36169341 TGGTGGGCAGGAACTGGGGAAGG - Intergenic
1165790694 19:38489961-38489983 ATTTTGGCTGGACCTGGGCAGGG + Intronic
1165854406 19:38870986-38871008 CTGGGGGCTGGAAGTGAGGAGGG + Exonic
1166072463 19:40395135-40395157 CTTTGGGCTGGCTCGAGGGAAGG - Exonic
1167121790 19:47521556-47521578 ATTTGGGCTGGAGCTGAGGATGG + Exonic
1167369275 19:49071245-49071267 CTCTGGGCTGGGACTGTGGAGGG - Intronic
1167520145 19:49949996-49950018 CTTTGGGCTTCAATTGGAGAGGG - Exonic
925356633 2:3246674-3246696 CTGTGGGCTGGAGCTGAGCAAGG - Intronic
925733624 2:6941894-6941916 CTGTGAGCTGGGACTGGGCAGGG + Intronic
927143421 2:20145064-20145086 CTCAGGGCTGGGACTGGGGACGG - Intergenic
927504123 2:23602284-23602306 CTTTGGGCAGGCCCTGGGGCAGG - Intronic
927525217 2:23733805-23733827 CTATAGGCCGGGACTGGGGAAGG - Intergenic
927863858 2:26576601-26576623 CGTGGGGCTGGAACTGGGGCTGG - Intronic
929034837 2:37680722-37680744 CACTGGGGTGGAATTGGGGAAGG - Intronic
929175471 2:38971182-38971204 CTTTTGTTTGGAGCTGGGGATGG - Intronic
932750219 2:74366759-74366781 TTTAAGGCTGCAACTGGGGAAGG - Intronic
933726805 2:85431578-85431600 CTTTGCTCTGGAGGTGGGGAGGG - Intronic
933778986 2:85788482-85788504 CTTTGGGCTGGGACTGGTGATGG - Intergenic
933849679 2:86355840-86355862 CTTTGGGCAGGAAATGGAGGGGG + Intergenic
933942936 2:87260288-87260310 CATTGGGCTGGAACCCCGGAAGG + Intergenic
934109225 2:88726197-88726219 CTTTGGTCAGGTACTGGGGTGGG + Intronic
936337277 2:111601274-111601296 CATTGGGCTGGAACCCCGGAAGG - Intergenic
937250174 2:120518893-120518915 CTTTCTGCTGCACCTGGGGATGG + Intergenic
937332341 2:121039354-121039376 CTTTGGCCGGGACCTGGTGAGGG - Intergenic
938381223 2:130837493-130837515 CAAGGGGCTGGAACTGGGGTCGG + Intronic
945285660 2:208078851-208078873 CTCTGGGCTGGTACTGAGGAGGG - Intergenic
945836274 2:214839178-214839200 CTTTAGGCAGGAAAGGGGGAGGG + Intergenic
946538390 2:220657306-220657328 CTTTGGGCTGGTTCTAGGGGTGG + Intergenic
946903461 2:224394288-224394310 CTGAGGGCTGGAACTCAGGAGGG - Intronic
947498166 2:230653982-230654004 CTTTGGGGAGGCTCTGGGGAAGG - Intergenic
948401555 2:237689318-237689340 CTTTGCTCTTGAGCTGGGGATGG + Intronic
1169276563 20:4237062-4237084 CTTGGGGCTGGAGCTGAAGAGGG + Intronic
1171846976 20:30283292-30283314 CTGGGGGCTGGGACTGGGGCTGG + Intergenic
1172023753 20:31934312-31934334 CTGTGGGATGGAGCTGGGGAGGG - Intronic
1172400982 20:34651222-34651244 CTTTAGGCTGGAACTTCTGAAGG - Intronic
1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG + Intronic
1172608364 20:36231027-36231049 CTTTGTCCTGGGACAGGGGAGGG - Exonic
1172867642 20:38112465-38112487 CTTGGGGCTGGGGCTGGGAAGGG + Intronic
1174354309 20:49988103-49988125 CTTCCTGCTGGAGCTGGGGAAGG - Exonic
1174542929 20:51303977-51303999 CTGTGGGCTGGAGCGGGGCAAGG - Intergenic
1176075300 20:63245532-63245554 CTTTGGGGTGGACCTGGGGCTGG - Intronic
1176076546 20:63250936-63250958 CTTTTGGCTGGGATGGGGGATGG - Intronic
1177174496 21:17689526-17689548 CTCTGGGCAAGAACTCGGGAGGG - Intergenic
1178753406 21:35325349-35325371 CTTTGGGTGGGAACTGTTGATGG - Intronic
1179054191 21:37916243-37916265 GTTTGGGCAGGGACGGGGGAGGG + Exonic
1180657668 22:17436880-17436902 CTTTAGGCAGGAACTGGGGGTGG + Intronic
1180859361 22:19068540-19068562 CATGGGGCTGGAACTGCTGAGGG - Intronic
1181178543 22:21051775-21051797 CTTGGAGCTGGGCCTGGGGAGGG - Intronic
1183250269 22:36725472-36725494 CTTTGGCCTCAAACTGGGAACGG + Intergenic
1183336271 22:37248697-37248719 ATTTGGGCTGAAAATGAGGAAGG - Intergenic
1183477145 22:38042031-38042053 CTTTGGGGAGGAGTTGGGGAAGG + Intergenic
1184046945 22:41977599-41977621 CCTAGGGCTGGAACTGGGGTGGG + Intronic
1184411437 22:44328620-44328642 CTTTGGGGTGGGGCTGGAGAGGG + Intergenic
1184588205 22:45462049-45462071 CAGTGAGCTGGAACTGGAGAAGG + Intergenic
1185139555 22:49092701-49092723 CTGTGGGCGGGAAGAGGGGAAGG - Intergenic
950266677 3:11578420-11578442 CTTAGGGCTGGACCATGGGAAGG - Intronic
950802369 3:15564051-15564073 CCTTGGGGTGGAACAGGGTATGG - Intronic
953054365 3:39376004-39376026 CTTTGGGCTCAAACTGGAGAAGG + Intergenic
953291574 3:41669372-41669394 CTTTGGGGTGGGAGTGGGGAGGG - Intronic
953404609 3:42654296-42654318 CTGGGGGCTGGAGCTGGGGCTGG + Intronic
953625312 3:44566078-44566100 TTGTGGGCTGGAACTGGTAAGGG + Intronic
954128815 3:48549381-48549403 CTTAGGGATGGAGCTGGGGGTGG - Intronic
954353487 3:50065152-50065174 CCTAGGGCTGGGGCTGGGGATGG + Intronic
955113124 3:55969478-55969500 CATTTGGCTGGGACTGGAGATGG - Intronic
955707477 3:61743168-61743190 CTTCGGGCTGGAAATGAGGTAGG + Intronic
956174476 3:66460099-66460121 GATAGGGCTGGGACTGGGGAGGG - Intronic
958103991 3:89049422-89049444 CTGTGGGTTGGACCAGGGGAGGG + Intergenic
960148709 3:114230616-114230638 CTTTGGGGTGTGACTGAGGAAGG - Intergenic
960358589 3:116682902-116682924 TTTTGGGCTGGAGTTAGGGATGG - Intronic
960463118 3:117961265-117961287 CTAGGGGCTGGACCTAGGGAAGG - Intergenic
960516603 3:118608665-118608687 CTCTGGGCTGATACTGGGGATGG - Intergenic
960756528 3:121019611-121019633 CTCTGGGCTGGTACTGGGTGGGG - Intronic
960968836 3:123124622-123124644 CCACGGGTTGGAACTGGGGAGGG + Intronic
960988575 3:123296052-123296074 CCTGGGGCTGGACCTGGGGAGGG - Intronic
961197415 3:125014528-125014550 CTGGGGGTGGGAACTGGGGAGGG + Intronic
961658543 3:128456453-128456475 CTGTGTGCTGGGACTTGGGAAGG - Intergenic
961919929 3:130414969-130414991 CTTTGGGGTGGATGTGGGGGTGG + Intronic
962356588 3:134699338-134699360 CTGTGGCCTGGAAGTTGGGAGGG + Intronic
962527358 3:136248776-136248798 CTATGAGCTGGATCTGGGAAGGG + Intergenic
964755185 3:160085952-160085974 CTTGGGGCTGGGGCTGGGGTTGG - Intergenic
964926121 3:161960268-161960290 CTTTGTGCTGGAATTGGCGTAGG + Intergenic
965705193 3:171499624-171499646 GTTTGGGCTGGTGCTGGGGATGG + Intergenic
967577173 3:191107757-191107779 CTTTGAGCTGGAGCTGGAGCTGG - Intergenic
967703241 3:192619360-192619382 GTGTGGGCAGGAACTGGGAAAGG + Intronic
968244866 3:197134682-197134704 CTTCTGGCTGGGACTGGGCATGG + Intronic
968653834 4:1770316-1770338 CTCTGGGGTGGAACCGGGGCGGG + Intergenic
968672664 4:1860185-1860207 CTTTGGGCTGGGACATGGGAGGG + Intergenic
968817314 4:2828782-2828804 CTGAGCGCTGGAACTGGGAATGG - Intronic
969410569 4:7025373-7025395 CCCTGGGCTGGAACTGAGGGGGG + Intronic
969573224 4:8022328-8022350 CTGTGGCTGGGAACTGGGGAGGG - Intronic
975669462 4:76766386-76766408 CTGTAGGCAGGAAGTGGGGAAGG + Intronic
976097257 4:81522241-81522263 CTTTGGGCTGCAGCTGCTGAAGG - Intronic
978093559 4:104747326-104747348 CTTGTGGCTGGAACTGGGGCTGG - Intergenic
978848418 4:113303517-113303539 CATTGGGCTAGAGCTGGAGATGG + Intronic
982263861 4:153520568-153520590 CTTTGGGCAGGAAACTGGGAAGG + Intronic
983225530 4:165082588-165082610 CTTTTGGAAGGATCTGGGGAGGG + Intronic
983818020 4:172156288-172156310 CTTGGGGCTGGGCCTGAGGAGGG + Intronic
984142811 4:176023889-176023911 CTTTACACTGGAGCTGGGGATGG + Intergenic
984743850 4:183194100-183194122 TTGTAGGCTGGGACTGGGGAGGG + Intronic
984855606 4:184193458-184193480 CTTAGGGCTGGAGGTGAGGATGG + Intronic
984865108 4:184274581-184274603 CTTTGGGGTGGAGTTGGGGCTGG - Intergenic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
985993217 5:3580582-3580604 CTAAGGGCTTGAACTTGGGAGGG + Intergenic
987091208 5:14509156-14509178 CTTGGGGCAGGAACAGGGGGAGG - Exonic
988907945 5:35809395-35809417 TTTTGTGCTGGAAGTGTGGAGGG + Intronic
989192111 5:38680694-38680716 CTTTGGGGTGGGATGGGGGATGG - Intergenic
992064133 5:73088999-73089021 TTTTGGCCTGCAACTGGGAAGGG + Exonic
992150423 5:73896955-73896977 CTTTCGGCTGCAAATGGGGCTGG - Intronic
992493453 5:77268483-77268505 GGTGGGGCAGGAACTGGGGATGG - Intronic
992720243 5:79553610-79553632 CATTGTGCTGGAGCTGGAGATGG + Intergenic
992840583 5:80687557-80687579 CTTTGAGTTGGTAATGGGGAGGG + Intronic
993029926 5:82694322-82694344 CTTTGGGATGGAGCTGAGGATGG - Intergenic
995748673 5:115430823-115430845 GTTTGGGAAGGAGCTGGGGAAGG - Intergenic
997355495 5:133260213-133260235 CTGTGGGGTGGAAATGGTGAAGG - Intronic
997977609 5:138449515-138449537 CTTTGGGTAGGGACTGGGGCAGG + Intergenic
998173767 5:139887595-139887617 CTTTGGGCTGGAACTGGGGAAGG + Intronic
999631651 5:153577540-153577562 CTTTGGGATGGAAGTGAGCAAGG - Intronic
999933357 5:156457988-156458010 TTGTAGGCTGGGACTGGGGAGGG - Intronic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001231975 5:169996667-169996689 CTTGGGCCTGGACCTGGGGCAGG - Intronic
1001755883 5:174168111-174168133 ATTTGGGGTGGAAATTGGGATGG - Intronic
1002301520 5:178259849-178259871 CTCTGGGCTGGCCCTGGGCACGG - Intronic
1003563980 6:7206899-7206921 CTTTGGGATGGAAGAGGGCAGGG + Intronic
1005244179 6:23862531-23862553 CTCTGAGCTGGTACTGGGAAGGG - Intergenic
1005997469 6:30940116-30940138 CTTTAGGCAGGAAGTGAGGAAGG + Intergenic
1006383655 6:33716444-33716466 CTTTGTGCTGGCACTGGCCAAGG - Intergenic
1006387524 6:33739604-33739626 CTGTGGGATTGAGCTGGGGAAGG + Intronic
1007377645 6:41467651-41467673 CCTTGGGGTGGAGCTGGGGGGGG + Intergenic
1007588318 6:43006477-43006499 CTTGGGGCTGGGGCTGGGGCTGG - Exonic
1007777530 6:44232152-44232174 AGTTGGGCTGGAAGTGGGGAAGG + Intronic
1010209459 6:73351645-73351667 CTCAGGGCTGGGACGGGGGAGGG + Intergenic
1011199212 6:84816846-84816868 ATTTGGAGTGGAACTAGGGAAGG + Intergenic
1012273495 6:97243864-97243886 GTCTGGGCTGGTACTGGGGTGGG + Intronic
1012276567 6:97282414-97282436 CTTAGAGCTGGAGCTGGGGACGG - Exonic
1012840558 6:104324314-104324336 CTTTGGGGTGGCAGGGGGGAGGG - Intergenic
1013067822 6:106700572-106700594 CTTTGGTCTGGGTATGGGGAGGG - Intergenic
1013583165 6:111555697-111555719 TTTTGGGGTGGAAGTGGGGTAGG - Intergenic
1013597074 6:111669937-111669959 ATTTGGTCTGGACATGGGGAAGG + Intronic
1016257453 6:142124994-142125016 TTCTGGAGTGGAACTGGGGATGG - Intergenic
1018850688 6:167588299-167588321 CGTGGAGCTGGAACTAGGGAGGG + Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020857553 7:13449056-13449078 CTCTCGGTTGGAGCTGGGGATGG + Intergenic
1020976762 7:15015947-15015969 CTTTGGCAAGGAACCGGGGAAGG + Intergenic
1021213916 7:17891984-17892006 TTTTGGGCTGGGAAAGGGGAGGG - Intronic
1023134442 7:37037358-37037380 TTTTTGGCTTGACCTGGGGAGGG - Intronic
1024020332 7:45362555-45362577 CTATGGGGTGGGAGTGGGGATGG + Intergenic
1024985165 7:55187969-55187991 CTTTGGGCTGGTCCTGAGGCAGG - Intronic
1026898925 7:74026857-74026879 GTGTGGGATGGAACAGGGGAGGG - Intergenic
1026994575 7:74606984-74607006 CTTTGGCTTGGAGCAGGGGAAGG - Intergenic
1027328973 7:77071290-77071312 CTCTGGGCTGGTACGGGGGTTGG + Intergenic
1028792849 7:94873271-94873293 CTCTGGGCTGGCAGTGGGCAGGG + Intergenic
1030328780 7:108250617-108250639 GGTTGGGGTGGAAATGGGGATGG + Intronic
1031993340 7:128211854-128211876 CATCGGGCTGGACCTGGGGGAGG + Intergenic
1032548337 7:132762023-132762045 CTTGGGGCTGGGGATGGGGAAGG + Intergenic
1033419975 7:141196905-141196927 CCTTGGGCTGTGAGTGGGGATGG + Intronic
1033426091 7:141245358-141245380 TTCTGGAGTGGAACTGGGGAAGG + Intronic
1034886044 7:154799577-154799599 ATTTGGGCTGGAAGGGGGGTTGG + Intronic
1035201880 7:157272961-157272983 CAGTGGGCAGGAACTGAGGACGG - Intergenic
1035785256 8:2254837-2254859 CTTTGGGGTGGCAATGGAGATGG - Intergenic
1035807552 8:2466879-2466901 CTTTGGGGTGGCAATGGAGATGG + Intergenic
1037803058 8:22045416-22045438 CTATGGGCTGGAGCTGGGGCTGG - Intronic
1037805619 8:22056742-22056764 CTATCAGCTGGAAGTGGGGAGGG + Intronic
1037920549 8:22802405-22802427 CTTTGGGCAGAAACTGGAGAAGG - Intronic
1037947002 8:22995973-22995995 CGTTGGGCTGGCACTGGGAAGGG + Intronic
1038112424 8:24514107-24514129 CTTTTGGCTAGGATTGGGGAGGG - Intronic
1039584400 8:38694057-38694079 CCCTGGGCTGGAACTGCAGAAGG - Intergenic
1039995839 8:42532350-42532372 GTTTGGGGTGGAGGTGGGGAAGG - Intronic
1040561937 8:48530332-48530354 CTTTGGGGTGGCATGGGGGAGGG - Intergenic
1040587189 8:48755340-48755362 AGTTGGGCTTGAACTGGGAAGGG + Intergenic
1041418009 8:57635066-57635088 TTTTGGGGTGGAATTGGGGATGG - Intergenic
1041645042 8:60243124-60243146 CTTTGGGCTGGATTTAAGGACGG - Intronic
1043305313 8:78786823-78786845 CTAGGGGCTGGGACTGGGGCTGG - Intronic
1044702123 8:94974544-94974566 CTGAGGGCTTGAGCTGGGGAAGG - Intronic
1044949524 8:97421917-97421939 CTTTGGGCTGGTATTTGTGAAGG + Intergenic
1045055185 8:98362619-98362641 CTTTGCCCTAGATCTGGGGAAGG - Intergenic
1045320182 8:101076541-101076563 GGCTTGGCTGGAACTGGGGAGGG - Intergenic
1048937466 8:139368856-139368878 CTGTGAGCTGCACCTGGGGAGGG + Intergenic
1049162177 8:141104683-141104705 CCCTGGGCTGGTCCTGGGGATGG + Intergenic
1049210915 8:141386053-141386075 GTCTGGGCTGCAGCTGGGGAGGG + Intergenic
1049472687 8:142783410-142783432 CCCTTGGCTGGAACTGGGGGTGG - Intergenic
1049655407 8:143794921-143794943 CTTTGGGCGGGGGCTGGGGTGGG - Intronic
1052142706 9:25006594-25006616 CTTTGGAATGGAATTGGTGATGG + Intergenic
1052307259 9:27024352-27024374 CTCTGGGCTTGTACTTGGGAGGG - Intronic
1052471174 9:28899355-28899377 GATTGGCCTGGAACTGGGGCAGG - Intergenic
1053434167 9:38064561-38064583 CTTTGAGCTGGATCTAGGGTTGG - Intronic
1054706375 9:68466734-68466756 CTGGGTACTGGAACTGGGGAAGG + Intronic
1056011281 9:82333340-82333362 CTCTGGGGTGGATCTGGGGTGGG - Intergenic
1056031772 9:82560766-82560788 CCTTGGGGTGGAACTTGGGGTGG + Intergenic
1056598276 9:88025595-88025617 CTTGGGGAGGGAACTGGGAAGGG + Intergenic
1056599699 9:88036975-88036997 CTCTGGGCAGGGGCTGGGGAAGG + Intergenic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1059658065 9:116374460-116374482 CTGTGTGCTAGAACTGGGAAAGG - Intronic
1059748145 9:117222713-117222735 CTTCTGGCTGCACCTGGGGAAGG - Intronic
1060216332 9:121740621-121740643 CTTTTTGCTGGCTCTGGGGAGGG + Intronic
1060235853 9:121862185-121862207 TTTTGGTCTGGAAATGTGGAGGG + Intronic
1060300213 9:122370740-122370762 CTTAGGGACAGAACTGGGGATGG - Intronic
1061183504 9:129038418-129038440 CTTGGAGCTGGAAGTGGGGGAGG + Intronic
1061751287 9:132778984-132779006 CATTGGCTTGGAAGTGGGGAAGG - Intronic
1061751294 9:132779021-132779043 CATTGGCTTGGAAGTGGGGAAGG - Intronic
1062071353 9:134556608-134556630 CCTTGGGCTGGACTTGGGCAGGG + Intergenic
1186317159 X:8383547-8383569 CATTTGGCTGCAACTGGGCACGG - Intergenic
1188485833 X:30680839-30680861 CTTTGGACTGGGACTGTGAAAGG + Intronic
1188511138 X:30937732-30937754 CTTTGGGATGGATATAGGGAGGG + Intronic
1188993044 X:36847513-36847535 TTCTGGGCTGGTACTGGGCAAGG - Intergenic
1189935624 X:46065661-46065683 GGTTGAGCTGGAAGTGGGGATGG - Intergenic
1190295978 X:49027999-49028021 CTGAGGGCTGGAACTGGGCTTGG - Intergenic
1190325550 X:49204980-49205002 CTCAGGGCTAGAACAGGGGATGG + Intergenic
1192240669 X:69325151-69325173 CTTAGGGCTGGGAGTGGGGTGGG - Intergenic
1192435516 X:71141349-71141371 CCTGGGGCTGGGACTGGGGCTGG - Exonic
1192706871 X:73535488-73535510 TTTCTGGCTGGAACTGTGGAGGG + Intergenic
1192896385 X:75447013-75447035 CATTGGGCAGTAACTGGGGTGGG - Intronic
1193567882 X:83101114-83101136 TTTAAGGCTGGAAGTGGGGAAGG + Intergenic
1193808496 X:86022835-86022857 CTTAGGGATAGAACTGGGGAAGG - Intronic
1195094693 X:101492418-101492440 TCTTGGGCTGGAGCTGGGGCTGG + Exonic
1195250760 X:103044349-103044371 GTTTGGGAAGGAAGTGGGGATGG - Intergenic
1195284261 X:103367860-103367882 CTCTGAGCTGGAAGTGGGGAGGG + Intergenic
1196044691 X:111245304-111245326 GTTTGGGGTGGAATTAGGGAAGG + Exonic
1197708797 X:129652142-129652164 CTTTGAGCTGGGCCTGCGGAGGG + Intronic