ID: 998173994

View in Genome Browser
Species Human (GRCh38)
Location 5:139889643-139889665
Sequence GTTTGTAATGGGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 436}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998173994 Original CRISPR GTTTGTAATGGGAAGGGGGA GGG (reversed) Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
902658363 1:17884934-17884956 GTTAGTAATGGGCAGGTGGAAGG + Intergenic
903049090 1:20587665-20587687 GTTTGGATGGGGAATGGGGAAGG - Intergenic
903320038 1:22537585-22537607 GTGTGTGATGGGAAGTGGGAGGG - Intergenic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903852489 1:26316476-26316498 GTTTGTGTAGGGGAGGGGGAGGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
906823080 1:48949665-48949687 GGTTGAAGTGGGAAGAGGGAAGG - Intronic
908499177 1:64725764-64725786 CTTTGTCATGGGAAGAGTGAGGG + Intergenic
910772426 1:90843590-90843612 ATTAATAATAGGAAGGGGGAAGG + Intergenic
911210581 1:95134372-95134394 GTTTGCAGTGGGCAGGGGAATGG + Intronic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911440963 1:97925290-97925312 GTTTTGAATGGGTTGGGGGATGG - Intergenic
911684508 1:100759404-100759426 GTTTGTTATGGGAAGGAAGAAGG + Intergenic
913061370 1:115211375-115211397 GGTTGAAGAGGGAAGGGGGAAGG - Intergenic
915167968 1:153959068-153959090 GTTTGTTTTGGGAAAGGGGTGGG - Intergenic
915839073 1:159201090-159201112 GTTTGGAATGGGGAGGGAGGAGG + Exonic
916490766 1:165300409-165300431 GGTTTTAATGGGAAGAAGGATGG - Intronic
918849385 1:189666174-189666196 GTTAGTAATTGGAAGGGAGAGGG - Intergenic
919301939 1:195781404-195781426 GAATGGAAAGGGAAGGGGGAGGG + Intergenic
919466608 1:197927829-197927851 ATTTTTACTGGGAAGGGGAAGGG - Intronic
919709297 1:200710369-200710391 GCCTGTGAGGGGAAGGGGGAGGG + Intergenic
919966345 1:202530326-202530348 GTTTGTCACGGGGAGGGGAAGGG - Intronic
920035008 1:203059991-203060013 GTGTGTGTTGGGGAGGGGGAGGG - Intronic
920103898 1:203536870-203536892 GTTTGTGTTGGCAACGGGGATGG - Intergenic
920398934 1:205665171-205665193 GTTAGTATTGGGGAGCGGGAGGG + Intronic
921004709 1:211081810-211081832 GCCTGTCATGGGATGGGGGACGG + Intronic
921241599 1:213189774-213189796 GTTCGGAAGGGGAAGTGGGAAGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922683769 1:227623013-227623035 GGTTCTAATTGGAAGGAGGAAGG - Intronic
923328733 1:232902974-232902996 GCTCGAAATGGGAAGGGGGTCGG + Intergenic
1063758005 10:9038265-9038287 GTTAGTAATGGGAAGGGAGCAGG - Intergenic
1064265052 10:13819358-13819380 AATTTAAATGGGAAGGGGGAGGG - Intronic
1064600975 10:16992233-16992255 GTCTGTCATGGGGTGGGGGAAGG + Intronic
1064754577 10:18562587-18562609 GATTGTAATGGAATGGGGAATGG + Intronic
1064755060 10:18565980-18566002 GATTGTAATGGAATGGGGAATGG - Intronic
1064756073 10:18572758-18572780 GTTTGAAATGGAATGGGGAATGG - Intronic
1064924171 10:20551753-20551775 GGTTGCCATGGGAAGGGGGCAGG - Intergenic
1065960669 10:30731904-30731926 TTTTGTAAGTGGAAGGGGCATGG - Intergenic
1066368294 10:34797742-34797764 AGTTGTAATGAGATGGGGGAAGG - Intronic
1066624448 10:37392021-37392043 GTTTGTAATGTGGATGTGGAAGG + Intergenic
1067714374 10:48678024-48678046 GCTTGGAAAGGGAAGGGGAATGG - Intergenic
1068366720 10:56060505-56060527 GTCTGTCATGGGGTGGGGGAAGG - Intergenic
1069290307 10:66770725-66770747 AATTGTGATGGGAAGGGGAATGG + Intronic
1069362106 10:67654332-67654354 GTTTGTATTGGGAAGTGTGAGGG - Intronic
1070446506 10:76509838-76509860 GTGTGTATTGGGTTGGGGGAAGG + Intronic
1070656165 10:78273066-78273088 GTTTGTACAGAGAAGGGGGCAGG - Intergenic
1071491102 10:86137017-86137039 GGGTGTGATGGGAATGGGGAAGG - Intronic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072562779 10:96591615-96591637 AATTGCAATGGGAAGGGAGAAGG - Intergenic
1072893375 10:99344849-99344871 CTTTGAACTGGGAAGGGGAAAGG - Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1074252988 10:111772180-111772202 ATTTATTATGGGAAGGGGGTAGG - Intergenic
1076002530 10:126923729-126923751 GTATGAAGTGGGGAGGGGGAGGG - Intronic
1076088128 10:127653785-127653807 GTTTGAAATGGGAATGAGGATGG - Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076323713 10:129604116-129604138 GTATGAAATGGGGAGAGGGAGGG + Intronic
1078509682 11:11976186-11976208 GTTGGTAATGGGAAGGGCACTGG - Intronic
1078517776 11:12039327-12039349 GTTGGTAAAGGGGAGGAGGACGG + Intergenic
1078637420 11:13064937-13064959 GTTTGTGATGGAATGAGGGAGGG - Intergenic
1078845004 11:15112632-15112654 GTGTGTATTGGGAAGTGGGGGGG + Intronic
1079029684 11:16977285-16977307 GTTTGGAAAGGGAAGGAGGGAGG - Intronic
1080594480 11:33758230-33758252 GTCTGGTATGGGATGGGGGATGG - Intronic
1080596769 11:33780082-33780104 ATTAGTAATGGGGTGGGGGAGGG - Intergenic
1081164982 11:39797619-39797641 GCCTGTAATGGGGTGGGGGAAGG - Intergenic
1081493390 11:43583521-43583543 TATTGTGAAGGGAAGGGGGAAGG - Intronic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1082223967 11:49678735-49678757 CTTTTTAATGGGAATGGTGATGG - Intergenic
1082920919 11:58492914-58492936 GGTTGTTAGGGGCAGGGGGAGGG + Intergenic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1084526285 11:69700447-69700469 GTCTGTAATGTAAAGGGTGAGGG - Intronic
1084570579 11:69957198-69957220 GTTTGTCAGAGGCAGGGGGAGGG - Intergenic
1085204000 11:74719365-74719387 GTGTGTACAGGGGAGGGGGATGG - Intronic
1085745163 11:79108919-79108941 GTTTGTGTGGGGAATGGGGAAGG - Intronic
1086427495 11:86700465-86700487 GTTTCTAGTGGGAGGTGGGAGGG + Intergenic
1086451944 11:86925979-86926001 CTTTCTGATGGGAAAGGGGATGG - Intronic
1086625073 11:88940427-88940449 CTTTTTAATGGGAATGGTGATGG + Intronic
1087146644 11:94819928-94819950 GTTAGGAATGGGGACGGGGATGG + Intronic
1087701810 11:101443613-101443635 GTATGTATTTGGAAGGGGGTGGG - Intergenic
1088051238 11:105517851-105517873 GTTTGCCAGGTGAAGGGGGAAGG + Intergenic
1088398664 11:109398354-109398376 GTTTGAGATGGGGAGGGTGATGG + Intergenic
1090092488 11:123710826-123710848 AGTTGGAATGGGCAGGGGGAAGG - Intergenic
1090128628 11:124116306-124116328 GTTTGTACTGGGAAGAGTGGGGG + Intronic
1091092415 11:132784422-132784444 CTTTATAATGGAAAGAGGGAAGG - Intronic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091309495 11:134562478-134562500 GCTTGTTCTGGGAGGGGGGATGG + Intergenic
1091774564 12:3175968-3175990 GCTTGTACTGGGAAGGAGAAAGG - Intronic
1092266112 12:6981749-6981771 GTTTTTAGTGAGATGGGGGAGGG + Intronic
1092378014 12:7971639-7971661 GTTTTTAAAGGGGAAGGGGAAGG - Intergenic
1092394089 12:8109828-8109850 GTGTGTAATGGGATGGTGTAAGG + Intergenic
1092884636 12:12914354-12914376 CTTTGTACTGAAAAGGGGGAAGG + Exonic
1093160917 12:15745349-15745371 GTTTTTTATGGGAACGGGGAGGG - Intronic
1095873441 12:47055306-47055328 GTTTGTAAAGTGAAGTGGCATGG - Intergenic
1096244602 12:49977177-49977199 GTTGGTAATGAGAGGGAGGAGGG + Intronic
1096451710 12:51748382-51748404 GTTTGCAATAGGAATGGGGTGGG - Intronic
1096760488 12:53837682-53837704 GTTAGTTTTGGGAAGGGGAAAGG - Intergenic
1097309062 12:58098877-58098899 GTTTATAAAGGGAAGCAGGAGGG - Intergenic
1098819358 12:75208912-75208934 GTTTTTCTTGGGAAGGGGGATGG - Intronic
1099935433 12:89119356-89119378 GTTTGTTGGGGGACGGGGGAAGG - Intergenic
1101735871 12:107462453-107462475 GTTTGCAATGGGAATGGTGATGG + Intronic
1101785715 12:107881636-107881658 TTTGGTAGTGGGAAGGGGCAGGG - Intergenic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104910951 12:132240822-132240844 GTGTGTAATGGGTATAGGGACGG - Intronic
1104910965 12:132240867-132240889 GTGTGTAATGGGTATAGGGACGG - Intronic
1104910978 12:132240912-132240934 GTGTGTAATGGGGATAGGGAGGG - Intronic
1104910995 12:132240957-132240979 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911011 12:132241002-132241024 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911023 12:132241047-132241069 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911037 12:132241092-132241114 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911049 12:132241137-132241159 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911064 12:132241182-132241204 GTGTGTAATGGGGATAGGGAGGG - Intronic
1104911079 12:132241227-132241249 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911095 12:132241272-132241294 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911109 12:132241317-132241339 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911125 12:132241362-132241384 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911141 12:132241407-132241429 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911157 12:132241452-132241474 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911170 12:132241497-132241519 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911186 12:132241542-132241564 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911202 12:132241587-132241609 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911217 12:132241632-132241654 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911233 12:132241677-132241699 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911246 12:132241722-132241744 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911261 12:132241767-132241789 GTGTGTAATGGGGATAGGGAGGG - Intronic
1104911307 12:132241902-132241924 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911323 12:132241947-132241969 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911338 12:132241992-132242014 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911354 12:132242037-132242059 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911370 12:132242082-132242104 GTGTGTAATGGGTATAGGGAAGG - Intronic
1104911385 12:132242127-132242149 GTGTGTAATGGGTACAGGGAAGG - Intronic
1104911397 12:132242172-132242194 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911413 12:132242217-132242239 GTGTGTAATGGGTATAGGGAAGG - Intronic
1104911428 12:132242262-132242284 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911444 12:132242307-132242329 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911460 12:132242352-132242374 GTGTGTAATGGGTATAGGGAAGG - Intronic
1104911475 12:132242397-132242419 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911488 12:132242442-132242464 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911504 12:132242487-132242509 GTGTGTAATGGGTATAGGGAAGG - Intronic
1104911519 12:132242532-132242554 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911535 12:132242577-132242599 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911551 12:132242622-132242644 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911567 12:132242667-132242689 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911583 12:132242712-132242734 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911599 12:132242757-132242779 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911615 12:132242802-132242824 GTGTGTAATGGGTATAGGGAAGG - Intronic
1104911630 12:132242847-132242869 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911646 12:132242892-132242914 GTGTGTAATGGGTATAGGGAAGG - Intronic
1104911658 12:132242937-132242959 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911674 12:132242982-132243004 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911690 12:132243027-132243049 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911706 12:132243072-132243094 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911722 12:132243117-132243139 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911738 12:132243162-132243184 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911752 12:132243207-132243229 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911768 12:132243252-132243274 GTGTGTAATGGGTATAGGGAGGG - Intronic
1104911779 12:132243295-132243317 GTGTGTAATGGGTATAGGGAGGG - Intronic
1106675803 13:31956738-31956760 GTTGGGAAGGGCAAGGGGGAGGG - Intergenic
1108203491 13:48064706-48064728 GTTTCCAAAGGGATGGGGGAGGG - Intronic
1110236990 13:73227433-73227455 GTGTGCATTGGGAAGGGTGAAGG - Intergenic
1110429710 13:75410227-75410249 CTTTGGAATGAAAAGGGGGATGG - Intronic
1110812763 13:79828770-79828792 GCCTGTCATGGGATGGGGGAGGG + Intergenic
1111359245 13:87153001-87153023 GTGGGGAATGGGAAGGGGGGAGG + Intergenic
1113387118 13:109859075-109859097 GTTTGCCATGGGCTGGGGGAGGG + Intergenic
1113611726 13:111650975-111650997 GTTTTTAATGTTAAGGGAGAAGG + Intronic
1113732680 13:112653272-112653294 GTTTGTAATGGAAAGGGGGCTGG - Intronic
1114654863 14:24310064-24310086 GTTGGTGATGGGAAGGAGCAGGG + Intronic
1115405148 14:33006484-33006506 GTGAGTAATTGGCAGGGGGAGGG + Intronic
1115788223 14:36850154-36850176 GTTGGCCATGGGAAAGGGGAAGG + Intronic
1115879499 14:37899265-37899287 GTTTGCAAGAGGAAGGGGGCTGG + Intronic
1117309978 14:54511413-54511435 GTTTGTAATTGGAATGAGGAAGG + Intronic
1117968165 14:61226860-61226882 GGTGGTAATGGGAAGTGGAAGGG - Intronic
1117979687 14:61330090-61330112 GCTTGTAATTCCAAGGGGGAGGG + Intronic
1118019971 14:61701630-61701652 TTTTATAATGGAAAGGGGGAGGG - Intronic
1118085575 14:62412123-62412145 GTTTCAAATGGGATAGGGGAGGG + Intergenic
1118203451 14:63699377-63699399 GTTTGTAAAGGGAAGAAGGGAGG + Intronic
1119597054 14:75944647-75944669 GGTTGTGGTGGGAAGGGGTAGGG - Intronic
1121005009 14:90484511-90484533 GGTAGGAATGGGAAGGTGGATGG - Intergenic
1121649085 14:95543738-95543760 GTTTGTAATTGGAAGAGTCAGGG + Intronic
1123116996 14:105899342-105899364 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1124916704 15:33982336-33982358 GTTTGGATTGGGATGGGAGAGGG - Intronic
1124968337 15:34457717-34457739 TTTTGTAGAGGGAAGGGGGGAGG - Intergenic
1125133097 15:36307517-36307539 GTTTTCAATGGGAAGGTTGAGGG + Intergenic
1125440435 15:39696920-39696942 GTGTGTGTTGGGATGGGGGAAGG + Intronic
1126227649 15:46289852-46289874 GGTTGCAATGGGAAGAGGGAGGG + Intergenic
1126393465 15:48185134-48185156 GTTTGTGAGGGGAAGAGGAAGGG + Intergenic
1127064482 15:55222619-55222641 GTTTATAGTGGGAAGGGAGGGGG - Intronic
1127625757 15:60778690-60778712 CTTTGAACTGGGAAGGGGTAAGG - Intronic
1128410468 15:67391965-67391987 TTTTGAGATGTGAAGGGGGATGG - Intronic
1128930177 15:71697268-71697290 TGATGTAATGGAAAGGGGGATGG + Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1130010628 15:80151012-80151034 GGTTTTAATGGGAAGGGGCAGGG + Intergenic
1130977870 15:88791041-88791063 GTATATAATGGGAATGGGTAGGG - Intergenic
1131733000 15:95301763-95301785 GCTTGGAAGGGTAAGGGGGATGG + Intergenic
1133703840 16:8334457-8334479 GTTTGTAATGGGAAAGGAAGAGG - Intergenic
1135542520 16:23342834-23342856 GTTTCTGATGGGGAGGAGGAGGG + Intronic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137714927 16:50592766-50592788 GGTGGTGATGGGGAGGGGGAGGG + Intronic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1138939997 16:61778488-61778510 TTTTGTTGTGGGAAGGGGCAGGG + Intronic
1139470579 16:67176115-67176137 GTGTGTAATGGGAGTGGGGCTGG + Exonic
1139803602 16:69544609-69544631 GTTTCTAAGGGGAAGGAGAAAGG + Intergenic
1140672562 16:77293402-77293424 GTGGGTAATGGGAATGGGGGTGG - Intronic
1140770526 16:78199720-78199742 TTTTTTTATGGGAAGGGGGTAGG - Intronic
1141105388 16:81229232-81229254 GTTTGCACTGGGAGGGTGGAAGG - Intergenic
1141536863 16:84687642-84687664 GTTTGTCATGGGGTGGGGAAAGG + Intergenic
1141727910 16:85801902-85801924 GTTTGCAATCTGAAGAGGGACGG + Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1143203336 17:5127041-5127063 GTTTGGGGTGGGAATGGGGATGG + Intronic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1145248740 17:21285851-21285873 ATTTGTCATGCGGAGGGGGAAGG + Intronic
1145903086 17:28500395-28500417 GTTTGGCAAGGGAAGGGGAAGGG + Intronic
1146473389 17:33142190-33142212 GTTTATCTTGGGAATGGGGAAGG + Intronic
1146792808 17:35762348-35762370 GTTTGTAAAGGAAAGAGGGGAGG - Intronic
1147134705 17:38428336-38428358 GTGGGTGGTGGGAAGGGGGAGGG + Intergenic
1147571998 17:41577079-41577101 GTCTGAATTGGGAAGGGTGATGG - Intergenic
1147847030 17:43411776-43411798 GTTTGAATTGGGGAGGGGGAGGG - Intergenic
1148330168 17:46809459-46809481 GTGTGTGTTGGGGAGGGGGATGG - Intronic
1148398543 17:47331737-47331759 GTTTGCCAGGGGATGGGGGAAGG - Intronic
1149387849 17:56159648-56159670 GTGTGTCTTGGAAAGGGGGAGGG - Intronic
1150284100 17:63945800-63945822 GGTGGTAAGGGGGAGGGGGAGGG + Intronic
1150855668 17:68750223-68750245 ATTTGTAATGGGTCGGGGTACGG - Intergenic
1151048924 17:70954282-70954304 GTTTCTAATTGGAAGAGGAAAGG + Intergenic
1151788405 17:76287980-76288002 GTTAGTAGAGGGAACGGGGAGGG - Intronic
1151889315 17:76942858-76942880 GTTTGCAAGGGGAGGGGAGAGGG - Intronic
1152238110 17:79148897-79148919 GTTTGTAAGGTCATGGGGGATGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153252133 18:3133455-3133477 GTTTCTAATGGGGAGAGGGTTGG - Intronic
1154133060 18:11752248-11752270 GTTTGCGGTGGGCAGGGGGAGGG + Intronic
1156189581 18:34702630-34702652 GTTATTAATTGGAATGGGGAAGG - Intronic
1156280607 18:35633536-35633558 GTCTGTTGTGGGATGGGGGAGGG + Intronic
1156284222 18:35675125-35675147 GTTTGAAGTGGGTAGGGGGATGG - Intronic
1156310016 18:35913227-35913249 GTGTGTGGTGGGATGGGGGAGGG - Intergenic
1157482447 18:48064205-48064227 GGTTGGAATGGCAAGGTGGATGG - Intronic
1157703771 18:49783278-49783300 GGTTGTCAGGGGATGGGGGATGG + Exonic
1158474677 18:57769393-57769415 GTTTGGAGTGGGAAGGCGCACGG - Intronic
1159134558 18:64321895-64321917 GGTAGTAAGGTGAAGGGGGAAGG + Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG + Intronic
1162705304 19:12551027-12551049 GTTTGTACTGGGACACGGGAGGG - Intronic
1162943940 19:14031307-14031329 GTTTGGACTGGGAAGGGGGCAGG - Intergenic
1162997368 19:14344734-14344756 GTTTGTGGTGGGAAGGGGACAGG - Intergenic
1163567653 19:18060978-18061000 CTTTAAAATGGGAAGGGGTATGG + Intronic
1164473585 19:28555630-28555652 GTTTGGGATGGGAAGCGGGTAGG - Intergenic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1166388600 19:42396506-42396528 GCTTGTAATGGAGAGGGAGAAGG - Intergenic
1167270324 19:48502382-48502404 GCTACTAAGGGGAAGGGGGAAGG - Intronic
1167823005 19:51946947-51946969 ATTTGGAGTGGGAAGGGGAAAGG + Intronic
1202644721 1_KI270706v1_random:129676-129698 GTTTCTAATATGTAGGGGGAAGG + Intergenic
925212021 2:2057480-2057502 GCTATTAATTGGAAGGGGGATGG - Intronic
925248975 2:2413051-2413073 GTCTGTTGTGGGATGGGGGAAGG - Intergenic
926238323 2:11066811-11066833 GCCTGTTATGGGATGGGGGAAGG - Intergenic
926728371 2:16015519-16015541 GTTTCGCCTGGGAAGGGGGATGG - Intergenic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
927694763 2:25232234-25232256 TTTTATAATGGGAGGGGGGATGG - Exonic
929078697 2:38100431-38100453 GTGTGCAATAGGAAGGGGGCTGG - Intronic
929427127 2:41854945-41854967 CTTGGCAATGGGAAGGGGAAGGG - Intergenic
929868799 2:45740540-45740562 GCTTGCAATGGGCAGGGGGAAGG - Intronic
929920702 2:46169232-46169254 GTTTGTGCTGGGGAGGGGGATGG + Intronic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
931168292 2:59775153-59775175 GTTTGGAAAGGGAAGAAGGAAGG - Intergenic
931300763 2:60975842-60975864 GTTTGAAACGGGGAGGAGGAGGG - Intronic
932291758 2:70586786-70586808 GTCTGGAAGGGTAAGGGGGAAGG - Intergenic
932818719 2:74881773-74881795 GTTCGGAATGGGAAGTGGGGTGG + Exonic
932836540 2:75043358-75043380 ATTTGAAATGGGGAGAGGGAAGG + Intergenic
933019055 2:77167793-77167815 GCCTGTCATGGGATGGGGGAAGG + Intronic
933899555 2:86839866-86839888 GTTTGTGATGGGCCGGGTGAGGG + Intronic
935781003 2:106509360-106509382 GTTTGTGATGGGCCGGGTGAGGG - Intergenic
936607876 2:113975968-113975990 GTATGTAAAGGGAAGGGCAAAGG + Intergenic
938311864 2:130295897-130295919 CTTTGCAACGGGAAGGGGAAGGG - Intergenic
938574335 2:132589872-132589894 TTTTATTAAGGGAAGGGGGAAGG + Intronic
938600241 2:132830300-132830322 GTTTTTAATGTGGAGGGGGATGG + Intronic
938995731 2:136675492-136675514 GTGTGTAGTGGGGAGGGGGGTGG - Intergenic
939095136 2:137825607-137825629 GTGAGTAGTGGGAAAGGGGAAGG + Intergenic
939330492 2:140753041-140753063 GTTTGCCAGGGGATGGGGGAAGG - Intronic
939617405 2:144376843-144376865 TTTTGTAGGGGGAAGGGAGAAGG + Intergenic
942224648 2:173804666-173804688 GTTTGCAGTGGGAAGGGACAGGG - Intergenic
944234219 2:197426773-197426795 GTTGGAAATGGGAGGGGTGAAGG - Intronic
944402599 2:199345413-199345435 GTTTGTGGGGGGAGGGGGGAGGG - Intronic
944526435 2:200624473-200624495 GTTTGGAAAGGGAAAGGGGAGGG + Intronic
946569627 2:221009479-221009501 GTTTGTAGTGTGTATGGGGATGG - Intergenic
947650692 2:231784111-231784133 GTTTGGACTGAGAAGGGGGAGGG + Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948564250 2:238873490-238873512 GTTGGGAGTGGGCAGGGGGATGG + Intronic
948859266 2:240745070-240745092 GTTGGGAATGGGAAGGAGGCAGG - Intronic
1168904361 20:1391927-1391949 GTTTGTATGGGGGCGGGGGAGGG - Intronic
1168922671 20:1553345-1553367 GTTGGTAATGGGAAGGTGACTGG + Intronic
1171126737 20:22608983-22609005 CTTTGTGATGGTAAGGGTGAAGG - Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1173180536 20:40803422-40803444 GTTGGGAGTGGGCAGGGGGAGGG - Intergenic
1173625292 20:44467871-44467893 GTTTGAATTGGGGACGGGGAGGG - Intergenic
1173670571 20:44796033-44796055 GATAGTGATGGGAAGGGGGATGG - Intronic
1173734132 20:45347882-45347904 GCGTGTACTCGGAAGGGGGAGGG - Intronic
1174499724 20:50975757-50975779 GATTGTAATGGGAATGGGCAGGG - Intergenic
1175414366 20:58792182-58792204 GTTTGGAGTGGGAGAGGGGAAGG - Intergenic
1176607157 21:8842979-8843001 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1177779956 21:25611568-25611590 GTTTGTAAGGGAAAAGGGGAAGG + Intergenic
1178288834 21:31349281-31349303 GTTTGTAACTGAAAGGGTGAAGG + Intronic
1178938900 21:36888415-36888437 TTTTTAAATGGGAAGGGGGCAGG - Intronic
1180357240 22:11852767-11852789 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1180381025 22:12139564-12139586 GTTTCTAATATGTAGGGGGAAGG + Intergenic
1181624664 22:24115051-24115073 GTTTGGAATGGGAAGGAAAAAGG + Intronic
1181917332 22:26291863-26291885 ATATGTACTGGGAAGGGGGATGG - Intronic
1182078618 22:27512702-27512724 GTTTGCACTGGGACAGGGGAGGG - Intergenic
1183593514 22:38795708-38795730 TGTTGTAGTGGGAAGGGTGAAGG - Intergenic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
950685882 3:14618366-14618388 GTTTGTGAGAGGTAGGGGGAAGG + Intergenic
951450682 3:22834533-22834555 GTTTTTAAAGGGAAAGGTGAGGG - Intergenic
952299299 3:32089817-32089839 GTTTGTGATGGGAGTGGGCAGGG - Intergenic
953014177 3:39056933-39056955 GATTGTAATGAGAAGAAGGAGGG + Intronic
953660479 3:44888015-44888037 CTTTGAAATGGAAAGGGGAAGGG - Intronic
953769911 3:45771957-45771979 GTCTGGAATGGGGAAGGGGAAGG + Intronic
955180737 3:56666863-56666885 ATGGGTAATGGGAAGAGGGAAGG - Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
956230306 3:67007662-67007684 GTTTGTATTGGGAAGGTACAAGG - Intronic
956807226 3:72827529-72827551 GTTTTTGGTGGGGAGGGGGATGG - Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958047951 3:88307873-88307895 GTTTGCAATGGGAAGGAGCCTGG + Intergenic
958829676 3:99072325-99072347 GTATGTAGTGGGGAGAGGGATGG - Intergenic
961450473 3:127000141-127000163 GTTTGTGCTGGGAGGTGGGAGGG + Intronic
962063504 3:131954645-131954667 GCCTGTCATGGGATGGGGGAAGG - Intronic
963243496 3:143035009-143035031 GTTTTAAATGGGTGGGGGGAGGG + Intronic
964107220 3:153052222-153052244 GTTTGTAATGGAAAGTGAAATGG - Intergenic
964609128 3:158591508-158591530 GATTGGAATTAGAAGGGGGAAGG + Intronic
964891158 3:161537243-161537265 GTTAGGAATAGGAAGGGAGATGG - Intergenic
965003375 3:162986640-162986662 GAATGTAATGGGGAGGTGGAGGG - Intergenic
965017847 3:163182354-163182376 GTTTGGACTGGGAAGCAGGAAGG + Intergenic
967790937 3:193548332-193548354 GGGTGTAATGGGAAGGGGAAGGG + Intronic
968536924 4:1137914-1137936 GTTTGTCATGGGCTGGGGGGAGG - Intergenic
968669241 4:1839865-1839887 GTATGTACGGGGAAGGGGCATGG - Intronic
969511048 4:7618192-7618214 GTTTTTAGCGTGAAGGGGGATGG - Intronic
970183372 4:13422742-13422764 GCCTGTCATGGGATGGGGGACGG + Intronic
970309029 4:14762247-14762269 GTAAGGAATGGGAAGAGGGAAGG + Intergenic
970318949 4:14856623-14856645 GTTTGTCCTGGGAGGAGGGAGGG + Intergenic
970652431 4:18193493-18193515 GTGTGTATTGGGTAGGGGGAAGG - Intergenic
972742382 4:41900040-41900062 TTTTGTAAAGGGAAGTGGGTAGG - Intergenic
973370962 4:49248235-49248257 GTTTCTAATATGTAGGGGGAAGG + Intergenic
974633929 4:64533762-64533784 GGTTGTAATGGGAATAGGGGTGG + Intergenic
974920447 4:68232851-68232873 ATTTGTAAGGGGGAGGGGGGAGG - Intronic
975207816 4:71664568-71664590 GTTAGTAAGGAGAAGGGAGAAGG + Intergenic
975281810 4:72569609-72569631 GTTAATTATAGGAAGGGGGAGGG + Intergenic
975885341 4:78958416-78958438 ATTTGTCAGGGGTAGGGGGATGG - Intergenic
976385701 4:84455475-84455497 GTTTGTGATGGGAAGGTGTAAGG - Intergenic
976479311 4:85521266-85521288 GTTAGTGTTGGGATGGGGGATGG - Intronic
978815778 4:112903164-112903186 GTTTCTCATTGGAAGGTGGAGGG + Intronic
979438992 4:120728666-120728688 GTATGTAAGGGGCAGGGGGCGGG - Intronic
982335260 4:154229406-154229428 TTTTGTAAGGGGAATTGGGATGG + Intergenic
983395166 4:167184976-167184998 GTTTGAAATAGGGAGGGGCAGGG - Intronic
983520992 4:168708939-168708961 GTTTGTTGTGGAAAGGTGGAGGG + Intronic
983549125 4:168996419-168996441 GTTAGTAATGGGAAATGGAAAGG - Intronic
985034980 4:185829553-185829575 GTGTCTAGTGGGAACGGGGATGG - Intronic
988631522 5:32936641-32936663 GGTTTTAATGGGAAGGTGTAAGG + Intergenic
988673157 5:33403924-33403946 GTTTGTATTAGGAATGGGTAAGG + Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989469206 5:41795404-41795426 GATTGTGAAGGGAATGGGGATGG - Intronic
990908757 5:60832722-60832744 TTTGGAATTGGGAAGGGGGAAGG - Intronic
994581680 5:101650591-101650613 GTTTGTACAGGTAATGGGGATGG - Intergenic
995015881 5:107307966-107307988 ACTTTTAATGGGAAGAGGGAAGG - Intergenic
996392555 5:122977333-122977355 GTATGTATTGGGAAGGGGTGGGG - Intronic
996778706 5:127160312-127160334 GTTTGGGAGGGGAATGGGGATGG - Intergenic
996978047 5:129459225-129459247 GTGTGTAATGGGGTGGGGTAGGG + Intergenic
997682541 5:135766341-135766363 GTTTGTAATATCAAGGGGGGGGG + Intergenic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998420050 5:141976732-141976754 GCATGTAAATGGAAGGGGGACGG - Intronic
998860006 5:146433362-146433384 GTTTGTTGTGGGGTGGGGGAAGG - Intergenic
999039568 5:148392405-148392427 CTTTGTTTTGGGGAGGGGGAGGG + Intronic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1001094438 5:168765400-168765422 GTTTGTAATAACAAGGGGGTCGG + Intronic
1001160758 5:169310785-169310807 GTCTGTCATGGGGTGGGGGATGG - Intergenic
1001437530 5:171711894-171711916 GTTTGCAAAGAGAAGGGAGACGG + Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1003264500 6:4553371-4553393 GAATGTAATGGGATGGGGAAGGG + Intergenic
1004869486 6:19890379-19890401 GTTTGAGATGAGGAGGGGGATGG - Intergenic
1004954241 6:20709827-20709849 GTATGTAATGGGAAAGAGGCTGG + Intronic
1004961817 6:20798755-20798777 GCCTGTAATGGGATGGGGGGAGG + Intronic
1005797350 6:29379854-29379876 GTACTTAATGGGAAGGGAGATGG - Intronic
1006191872 6:32214258-32214280 GGTTGTAAAGAGAAAGGGGAGGG + Intronic
1006505549 6:34486490-34486512 GACTGAAATGGGAAGCGGGAGGG - Intronic
1006856402 6:37136496-37136518 GTTTGGAAAGGGAGGGAGGAGGG + Intergenic
1008558832 6:52703460-52703482 ATTTGTAAAGGGAGGAGGGAAGG - Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1010643598 6:78360194-78360216 GCTTGTCATGGGGTGGGGGAGGG + Intergenic
1012971389 6:105735517-105735539 GTTTGGAATGAGAAGGGGCATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013366701 6:109442640-109442662 GCTTGAAATGGGAAGTGGGATGG + Intronic
1015616955 6:135087509-135087531 GTTGGGAAGGGGAAGGGGAAGGG - Intronic
1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG + Intergenic
1016647344 6:146425360-146425382 ACTTGGAATGGGAAGGGGCATGG + Intronic
1018100031 6:160429425-160429447 GTTTACCATGGGCAGGGGGAAGG - Intronic
1018617012 6:165696096-165696118 GTTGGTGTTGGGGAGGGGGAAGG + Intronic
1018633384 6:165839887-165839909 GTTGGAGATGGGAATGGGGATGG - Intronic
1021664949 7:22967958-22967980 GTTCCTAAAGGGAAGAGGGATGG - Intronic
1022815720 7:33912394-33912416 GTTTGAAATGGGATGGGGAAGGG - Intronic
1023421894 7:39989348-39989370 CTTTTTAATGGGGAGTGGGAGGG - Intronic
1024022633 7:45385828-45385850 GTAGGGAATGGGAAGGTGGAAGG + Intergenic
1024797666 7:53037390-53037412 GTTAGCACTGGGAAAGGGGAAGG + Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1028155750 7:87427473-87427495 CTTTTTAATGGGAATGGGGGTGG + Intronic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032638028 7:133732600-133732622 GTTTGAATTGGGAAAGGGCATGG - Intronic
1033050561 7:138000687-138000709 GTTTGTAATGGGGGTGGGGCTGG - Intronic
1033066814 7:138163927-138163949 GTGTGCATTGGGAAGTGGGATGG + Intergenic
1033217447 7:139503598-139503620 GTCTGGAATGGGAGGGGGCATGG + Intergenic
1034246689 7:149650045-149650067 GTTTGGAATGGGGATCGGGATGG + Intergenic
1034452222 7:151143135-151143157 GTGGGTAATGGAAAGGGGGGTGG - Intronic
1036776300 8:11615106-11615128 GTTTGTTCTGGGAAGGGAGAGGG + Intergenic
1037086209 8:14853896-14853918 TTTTGTATTGGCAAGGAGGAAGG - Intronic
1037247336 8:16850177-16850199 GCTTGAAATGGGGAGGTGGAGGG + Intergenic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1039743638 8:40404527-40404549 GTTTGCAATGGGAAAAAGGAAGG + Intergenic
1040577642 8:48667685-48667707 ATTAGTAAGGGGAAGGGGGCTGG - Intergenic
1040978657 8:53222006-53222028 GTTTGTCCTAGGAAGGGGAAAGG - Intergenic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041865951 8:62573113-62573135 GTATGTCATGGCAAGGAGGAAGG - Intronic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1044947995 8:97408766-97408788 GTTTTTAGTGGGAAGGGGTATGG + Intergenic
1045105544 8:98889008-98889030 GTTTGTAGTGGGAGGGGAGGAGG - Intronic
1045393850 8:101740848-101740870 GTTCCTGCTGGGAAGGGGGATGG - Intronic
1045807043 8:106175276-106175298 GGTTGGAGTGGCAAGGGGGAAGG - Intergenic
1045816257 8:106280558-106280580 GTTTGCAAGGGGATGGGTGATGG + Intronic
1045913602 8:107439939-107439961 GTGGGTAATTGGAATGGGGAGGG + Intronic
1046676901 8:117119380-117119402 GTTTCTAAAGGAAAGGGGAAAGG + Intronic
1047358969 8:124150237-124150259 GTTTGTCATGGAAAGGGCAACGG - Intergenic
1047506347 8:125483667-125483689 GGTTGGCATGGGAAAGGGGAGGG + Intergenic
1047527246 8:125644081-125644103 GTTTGTAATGGCAGGGGCCAGGG + Intergenic
1047811837 8:128418800-128418822 GATGGTAATGGGAATGGGCAAGG + Intergenic
1048707852 8:137174360-137174382 GTTTACCATGGGATGGGGGAAGG - Intergenic
1049275661 8:141718912-141718934 GTTTGTGATGGGAACTGGGAGGG + Intergenic
1049359557 8:142205810-142205832 GGATGTGAGGGGAAGGGGGAAGG + Intergenic
1049794261 8:144489305-144489327 GGTTGGACTGGGAAGGGGGTTGG + Intronic
1050163349 9:2740391-2740413 GATTGTGATAAGAAGGGGGAGGG + Intronic
1050615958 9:7402050-7402072 GTGTGTGTTGGGAAAGGGGATGG - Intergenic
1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG + Intergenic
1051131009 9:13861056-13861078 GTTTGCAATGAGAAGGAGGCAGG - Intergenic
1051332718 9:16039854-16039876 GTGTGTAATGGGGTGGGGGGTGG + Intronic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1052060402 9:23953788-23953810 TATTGTAATGGGTTGGGGGAAGG - Intergenic
1052365343 9:27606469-27606491 CTTTGTAATGGTAAGGAGAAAGG - Intergenic
1052625348 9:30968459-30968481 GTCTTTAATGGAAAGGAGGAAGG + Intergenic
1053362205 9:37496440-37496462 TGTTTTAATGGGAAAGGGGAGGG - Intronic
1055355301 9:75431554-75431576 ATTTGTGTTGGGAAGTGGGAAGG - Intergenic
1055950263 9:81723846-81723868 GTGTGGAATGGGCAGGGTGAGGG - Intergenic
1055994410 9:82141688-82141710 GTCTCAAATGGGAAAGGGGATGG - Intergenic
1057789867 9:98117805-98117827 GTAGGTAGTGGGTAGGGGGATGG + Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1057964398 9:99489076-99489098 GCTTGTTCTGGGCAGGGGGAGGG - Intergenic
1058388657 9:104469142-104469164 GTTTGTAATGTGAAGCAAGAAGG + Intergenic
1058632097 9:106999922-106999944 GTTTGTAGTTGGACTGGGGAGGG + Intronic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1059934790 9:119298822-119298844 GTATGTAAAGGGAAAGGAGAGGG - Intronic
1062141397 9:134961049-134961071 GTGTGTGATGGGAGAGGGGAGGG + Intergenic
1062298678 9:135850848-135850870 GTTTGTAAAGGGCAGGGGGAAGG + Intronic
1203695367 Un_GL000214v1:93034-93056 GTTTCTAATATGTAGGGGGAAGG + Intergenic
1203702493 Un_KI270742v1:7870-7892 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1203554473 Un_KI270743v1:193926-193948 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1203640906 Un_KI270751v1:11029-11051 GTTTCTAATATGTAGGGGGAAGG - Intergenic
1186484249 X:9921622-9921644 GGTTGTTAGGGGATGGGGGAAGG - Intronic
1186590201 X:10922293-10922315 GATTGGAATGGAGAGGGGGAAGG + Intergenic
1187904949 X:24056930-24056952 GTTTCTAGTAGGAAGGGGTATGG + Intronic
1188024092 X:25190147-25190169 GGTTGGGATGGGAAGAGGGAAGG + Intergenic
1188844109 X:35052712-35052734 GGCTGTAATTGGAAGGAGGATGG - Intergenic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189320279 X:40083438-40083460 ATTAGTAAGGGGGAGGGGGAAGG + Intronic
1189323517 X:40099434-40099456 TTTTATACTGGGAAGGGGGTGGG + Intronic
1190364815 X:49682042-49682064 TTTTGTAATGGCAAGAGGTAGGG + Intergenic
1190947981 X:55114461-55114483 ATATGTAATGGCAAGGGGAAGGG + Intronic
1191782549 X:64884516-64884538 GTCTGTCATGGGGTGGGGGAAGG + Intergenic
1194385295 X:93244846-93244868 GTTGGGACTGGGCAGGGGGATGG + Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195819950 X:108933852-108933874 GACTGTTATGGGATGGGGGAGGG - Intergenic
1196669276 X:118348049-118348071 GTGTGTATTGGGGTGGGGGAGGG + Intronic
1196672125 X:118379665-118379687 GATTGTAATGGAAATGGAGAAGG + Intronic
1197129471 X:122988366-122988388 CTTTGTAATGTGAAATGGGAAGG + Intergenic
1198309194 X:135413343-135413365 GTTTCTATTGGGTAGGGGGTTGG - Intergenic
1199698860 X:150362285-150362307 GGTGAAAATGGGAAGGGGGATGG + Intronic
1199874310 X:151919313-151919335 AATAGTAATGGGAAAGGGGAGGG - Intronic
1199874480 X:151919986-151920008 GATGGGAATGGGAAGGGGGATGG - Intronic
1200883439 Y:8244526-8244548 GCTTGTCATGGGATGGGGGGAGG + Intergenic
1201338476 Y:12905294-12905316 GTTTGTGAGGGGGCGGGGGAGGG + Intronic
1202301967 Y:23426124-23426146 GTTTGTCACGGGGAGGGGAAGGG - Intergenic
1202568844 Y:26244474-26244496 GTTTGTCACGGGGAGGGGAAGGG + Intergenic