ID: 998176277

View in Genome Browser
Species Human (GRCh38)
Location 5:139904065-139904087
Sequence GCGTGGGGACGCGGCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998176264_998176277 12 Left 998176264 5:139904030-139904052 CCGGTACCGGCGTGCAGCGCCTC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG 0: 1
1: 0
2: 0
3: 26
4: 207
998176267_998176277 -7 Left 998176267 5:139904049-139904071 CCTCTTGCCCGCCCCTGCGTGGG 0: 1
1: 0
2: 2
3: 15
4: 162
Right 998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG 0: 1
1: 0
2: 0
3: 26
4: 207
998176265_998176277 6 Left 998176265 5:139904036-139904058 CCGGCGTGCAGCGCCTCTTGCCC 0: 1
1: 0
2: 2
3: 5
4: 114
Right 998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG 0: 1
1: 0
2: 0
3: 26
4: 207
998176263_998176277 20 Left 998176263 5:139904022-139904044 CCTGCAGGCCGGTACCGGCGTGC 0: 1
1: 0
2: 0
3: 5
4: 41
Right 998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG 0: 1
1: 0
2: 0
3: 26
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998176277 Original CRISPR GCGTGGGGACGCGGCCGCCC GGG Intronic
900161387 1:1225588-1225610 GGCTGGGGACGGGGCCACCCGGG + Intronic
900393556 1:2444026-2444048 GCGCGGGGGCGCCGCAGCCCTGG + Intronic
900983802 1:6061395-6061417 GTGTGGGGACACGCCCGGCCCGG - Intronic
901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG + Intronic
901628955 1:10638965-10638987 GCGCGGGGCCGGGGGCGCCCAGG + Exonic
902089643 1:13893097-13893119 GCGCGGGGACGCGGGAGCCCAGG + Intergenic
903069127 1:20717900-20717922 GCGGGAGGAAGCGGCGGCCCCGG - Exonic
903476033 1:23619690-23619712 GCGTGGGGCCCCGCCCGCCCAGG - Intronic
904181388 1:28668960-28668982 GCGTGGGGAGGCGCCCGCGGAGG - Intronic
904602224 1:31679921-31679943 GCGTGGGGAGGCGGCTGGCTGGG + Intronic
905626283 1:39492154-39492176 GCGCGGGGCCGGGGCCGCCCGGG - Exonic
905670613 1:39788301-39788323 GCGCGGGGCCGGGGCCGCCCAGG + Exonic
906720016 1:47997477-47997499 GCGAGGGGCCGGGGCCGCGCCGG + Intergenic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
910145706 1:84078003-84078025 GCCTGGGCGCGCGGCTGCCCGGG + Intergenic
910759028 1:90717691-90717713 CCGAGGGCGCGCGGCCGCCCGGG - Intergenic
911133827 1:94418432-94418454 GCGAGGGGACGCGGCGGCGGCGG - Intergenic
912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG + Intronic
913449794 1:118985447-118985469 GCGTGGAGACGCGGCGGTCCAGG - Intronic
915303042 1:154962207-154962229 GCGGGAGGTCGCGGCCGCCCAGG - Intronic
915458214 1:156054056-156054078 GCGTTGGGTCGCGGTCTCCCGGG - Intergenic
921472567 1:215567196-215567218 GCGTGGGCAGGCGGCTGGCCAGG + Intergenic
922539404 1:226407763-226407785 GGGCGGGGACGCGGCGCCCCGGG - Intronic
923506754 1:234611057-234611079 GCGCTGTGACGCGGCCGCGCTGG - Intergenic
924289763 1:242524836-242524858 GAGCGGGAGCGCGGCCGCCCGGG - Intergenic
1062951276 10:1505698-1505720 GCATGGGGAGGCGGCTGCCACGG - Intronic
1062951292 10:1505747-1505769 GCATGGGGAGGCGGCTGCCATGG - Intronic
1063145388 10:3290805-3290827 GCGTGGGGTCTCGGCAGGCCTGG + Intergenic
1063418307 10:5890495-5890517 GCGTGGGGGCTCGGCCGTCCGGG + Intronic
1064141618 10:12795467-12795489 GTGTGGGGAGGTGGCCTCCCTGG - Intronic
1066259506 10:33715468-33715490 GAGTGGCGAGGCGGCAGCCCTGG + Intergenic
1067077205 10:43194947-43194969 GCCTGGGGAGGAGGCAGCCCTGG - Exonic
1067112302 10:43409059-43409081 GGGTGGGGACGCGGGCTCCTTGG - Intronic
1068866834 10:61903371-61903393 CCGAAGGGAGGCGGCCGCCCCGG - Intronic
1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG + Intergenic
1074923804 10:118046775-118046797 GGCGGGGAACGCGGCCGCCCCGG + Intergenic
1075031970 10:119029834-119029856 GCGGGGGGGCGCGGCCGCGGCGG - Exonic
1075369990 10:121927800-121927822 GCGTGGGAAGCCGGGCGCCCGGG - Intronic
1075724312 10:124603767-124603789 GCGTGGGGACCCTCCAGCCCAGG - Intronic
1076697241 10:132252865-132252887 GCGTGGGGCCGCCTCCTCCCAGG + Intronic
1077118089 11:894423-894445 GCGTGTGCACACGGCCGGCCTGG - Intronic
1077122217 11:914825-914847 GGGTGGGGTCGCGGCGGCTCTGG + Intronic
1078594456 11:12674584-12674606 GTGCCTGGACGCGGCCGCCCCGG - Exonic
1079450780 11:20598297-20598319 GCCTGCGGCCGCGGCCGCCGCGG + Intergenic
1081705532 11:45180553-45180575 GCGGGAGGAAGCGGGCGCCCGGG - Intronic
1083795558 11:65014580-65014602 GCGTGGGGCCGCTGCCCTCCCGG + Intronic
1084153947 11:67303655-67303677 GCGTGGAGGCGCCGCTGCCCGGG - Exonic
1085031656 11:73274902-73274924 GGGTGGGGATCCGGCAGCCCAGG + Intronic
1085666222 11:78417621-78417643 GAGTGCGGGCGCGGCCGCCCAGG - Intronic
1091696949 12:2634007-2634029 GCGTGGGGCTGTGGCCGCCCCGG - Intronic
1092062597 12:5563612-5563634 GCCTGGGGAGGTGGCGGCCCTGG + Intronic
1093654309 12:21677300-21677322 GGATGGGGACGTGGCCGGCCAGG - Intronic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1095810961 12:46372826-46372848 GGGCGGGACCGCGGCCGCCCGGG + Exonic
1096262861 12:50103914-50103936 GGGTGGGGAGGCTGGCGCCCAGG - Exonic
1096466149 12:51848577-51848599 GCCTGGGGGCGCGTCCGGCCCGG + Intergenic
1101371684 12:104137481-104137503 CCGTGGGGCCGGGGCCACCCAGG - Intronic
1102136764 12:110582475-110582497 GGGAGGGGACGAGGTCGCCCAGG + Intronic
1103659240 12:122500562-122500584 GCGTGGGGCCGGGGCAGCGCCGG - Exonic
1112402144 13:99086556-99086578 GCGGGGGGCCGCGGACGCCGAGG - Intronic
1112752563 13:102597228-102597250 GCGCGGGGGCGCGGGCGGCCGGG + Intronic
1113657140 13:112073886-112073908 GCCTGGGGACGCAGTCGTCCGGG - Intergenic
1114312160 14:21477312-21477334 GCGAGAGAACGCGGCCGACCGGG + Intronic
1117315112 14:54565991-54566013 GCGTGCCGTCGCCGCCGCCCGGG + Intergenic
1118514163 14:66508342-66508364 GCGTGGGGGAGAGGCCGCGCCGG - Exonic
1118762868 14:68891114-68891136 TCGTGGGGAGACGGCAGCCCAGG - Intronic
1119539302 14:75428218-75428240 GCGGGGGGAGGCGGCGCCCCCGG - Intronic
1121253011 14:92513636-92513658 CCCCGGGGGCGCGGCCGCCCGGG + Intergenic
1121850792 14:97219538-97219560 GGGTGGGGACGCGGCGGTCTGGG + Intergenic
1122558005 14:102591979-102592001 GCCAGGGGAGGCGGCCGCCTGGG + Intergenic
1122629773 14:103102335-103102357 CGGTGTGGACGCGGCCGCGCTGG + Exonic
1122719619 14:103715125-103715147 GCGCGGGGAGGCGTCCGCTCAGG - Intronic
1122719912 14:103716119-103716141 GCCCGGGGACGCGGCCAACCTGG - Intronic
1122786380 14:104166099-104166121 GGGTGGGGAGGCGCTCGCCCTGG + Intronic
1126034977 15:44537264-44537286 GCGTGGGGCCGGCGCCGGCCCGG - Intronic
1130517186 15:84634217-84634239 AGGCGGGGACGCGGCCGCCGCGG - Intergenic
1132591192 16:727153-727175 GCGGGGGAACGCGGCTGTCCCGG + Intronic
1132729132 16:1352026-1352048 GCCTGGGGACGCGGACGGCCGGG - Intronic
1132841625 16:1980890-1980912 GCGTGGGGAAGCCGCCACCGCGG + Exonic
1132842372 16:1984338-1984360 GCGGAGAGACGCGGCCGCCTCGG + Exonic
1132889532 16:2196876-2196898 GGCTGGGGACGCGGCCGCCGGGG + Intergenic
1134539921 16:15055997-15056019 GCGGGGGGCCGCCGCCTCCCTGG - Exonic
1135034732 16:19067675-19067697 GCGGGGAGCCGCCGCCGCCCCGG - Exonic
1136245798 16:28975126-28975148 GCGGGCGGGCGCGGCCCCCCGGG + Exonic
1136381981 16:29900117-29900139 GCGTCGGGCCGGGCCCGCCCCGG - Intergenic
1136470006 16:30473737-30473759 GGGTGGGGAGGCAGCCCCCCAGG + Intronic
1138106372 16:54289060-54289082 ACGTTGGGACGCGGCTGCCTGGG - Intergenic
1138187684 16:54988819-54988841 ACGTGGAGACGTGGCTGCCCGGG - Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1142626902 17:1197986-1198008 GCGTGGGGCTGCGGCCAGCCGGG - Intronic
1142752757 17:1998393-1998415 GCGGGGAGCCGCGGCCGCGCTGG + Intronic
1142762278 17:2049781-2049803 GCGCAGGGAGGCGGCCTCCCGGG - Intergenic
1143036920 17:4004766-4004788 GCGCCGGGACGCGGCGGCTCTGG + Exonic
1149678701 17:58488480-58488502 GCTGGGGCACGCGGCCGCCGAGG - Intergenic
1152290496 17:79437315-79437337 GCAGGGGGACCCGGCCTCCCCGG - Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1153457333 18:5295596-5295618 GCGTGGGGCCGGGGCGCCCCGGG - Intronic
1154241513 18:12657786-12657808 GCGAGGGGCCGCGGGAGCCCGGG - Exonic
1154981803 18:21508586-21508608 GCGTGGGTAAGGGGCCCCCCTGG + Exonic
1155152708 18:23135567-23135589 GGATGGGGGCGCCGCCGCCCCGG - Intronic
1157496751 18:48161940-48161962 GCGCCGGGCCGCGGCCTCCCGGG - Intronic
1160025434 18:75211804-75211826 GCGCGGGGACGCGGGGCCCCGGG - Intronic
1160499296 18:79394413-79394435 GCGTGGGGGCGCGGCCTCGCTGG + Intergenic
1160552683 18:79705097-79705119 GGGTGGGGCCGCGGCTGCTCTGG + Intronic
1160813871 19:1026626-1026648 GCGGCGGGACGGGGCCGCACAGG - Exonic
1160904592 19:1446269-1446291 CCATGGAGCCGCGGCCGCCCCGG - Intergenic
1161210411 19:3062566-3062588 GGGGGGGGACGCGCGCGCCCGGG + Intronic
1161954994 19:7488857-7488879 GAGAGGGGACGGGGTCGCCCAGG - Intronic
1163153532 19:15428268-15428290 GAGGTGGGAGGCGGCCGCCCCGG + Intronic
1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG + Intronic
1163556678 19:17997291-17997313 GCGTGGGGACATGGCTGCCTAGG - Intronic
1163607266 19:18281981-18282003 GCGTGGGGCCCCGGCCGGGCGGG + Intergenic
1164693205 19:30226036-30226058 GGGCGGGGAGGCGGCGGCCCAGG - Intergenic
1165879471 19:39032182-39032204 GCGCGGGGACCCGGGCGGCCCGG + Exonic
1166100856 19:40570618-40570640 GCGCGGGGGCGGAGCCGCCCTGG - Exonic
1166797977 19:45439673-45439695 GCGTCGGGACGCGTCCGCCGGGG - Intronic
1168408271 19:56121623-56121645 GCCCGGGGACCCGGCCGCGCAGG - Intergenic
926121895 2:10245781-10245803 GAGTGGGGACGTGGCCTCCGTGG + Intergenic
929961470 2:46499810-46499832 GGGTGGGGGCGCGGCCGGCTGGG - Intronic
931348718 2:61470488-61470510 GCGCGGTGGCGCGGCCGCCGCGG - Intronic
933858509 2:86441649-86441671 GGGCGGGGACCCAGCCGCCCGGG + Intronic
937004221 2:118496617-118496639 GCTGTGGGATGCGGCCGCCCTGG + Intergenic
940453886 2:153872474-153872496 ACCTGGCGACGCGGCCTCCCGGG + Intronic
941508401 2:166376031-166376053 GGGTGGGGACCCGGGCGCGCTGG - Intergenic
942346066 2:175004771-175004793 GCGTGGGGTCGGGGCGGGCCGGG - Intronic
944615234 2:201452223-201452245 GCGCGGGGCCCAGGCCGCCCGGG + Intronic
944811199 2:203328695-203328717 GCGTGGGGCCGAGGCCGCCTCGG + Intronic
945673818 2:212832478-212832500 GCGTAGGGCCGAGCCCGCCCCGG + Intergenic
948264910 2:236629090-236629112 GTGTGGGGACGGTGTCGCCCAGG + Intergenic
1168806635 20:675624-675646 GTGCGGGGAGGCGGCCGGCCGGG + Exonic
1169557556 20:6767486-6767508 GCGGGGGCGCGCGGCCGCCAAGG - Intergenic
1170578355 20:17681217-17681239 GCGGGGGGACGAGGGCGCCCGGG - Intronic
1172061491 20:32190080-32190102 GCGCGGGGAAGCGGCCTCCACGG - Intergenic
1173251280 20:41365418-41365440 GCGTGGGGAAGAGGCCAGCCCGG + Intronic
1175234698 20:57501887-57501909 GGGTGGGGACGAGCCTGCCCAGG - Intronic
1175394681 20:58650374-58650396 GCGTCGGGCAGGGGCCGCCCGGG - Intergenic
1175429359 20:58891201-58891223 GCGGAGGGAGGCGGCCCCCCGGG - Intronic
1176075748 20:63247551-63247573 GCGTGGGGAAGGGGGCCCCCGGG - Intronic
1176173788 20:63708240-63708262 GCGGGGGGGCGCGGCCGGCCTGG + Intronic
1176214309 20:63941077-63941099 ACCTGGGGACGGGGCGGCCCCGG - Intronic
1178327890 21:31660047-31660069 GCGTGGGACCGAGGCCGCCGCGG + Intronic
1179600781 21:42476124-42476146 GGGTGGGGGCACGGCAGCCCAGG - Intronic
1179626704 21:42653358-42653380 GCGTGGGGAGGCGACGGCTCCGG + Intergenic
1179794687 21:43776172-43776194 CCGCGGGGACGGGGCCGGCCCGG - Intronic
1179800304 21:43808582-43808604 GCGGGGGGCCACGGCGGCCCAGG - Intergenic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180069962 21:45431335-45431357 GTGTGTGGACCCGGCGGCCCAGG + Intronic
1182604163 22:31490120-31490142 GCGTGGGAACGCGGCGGCGGTGG - Intronic
1182664022 22:31944488-31944510 GGGAGGAGACGCGGCCGCGCTGG - Exonic
1183423564 22:37725768-37725790 GCGGGGGGGCGAGGACGCCCGGG - Exonic
1184043290 22:41957155-41957177 ACGTGGTGACTCAGCCGCCCAGG - Intergenic
1184523228 22:45007787-45007809 GCGGGGGCGCGCGGCCGGCCGGG + Intronic
1185335917 22:50270798-50270820 GCGTTGGGACAGGGCCGGCCTGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950076989 3:10194244-10194266 GCGTGGGGAAGCGTCGGCTCTGG - Intronic
968562285 4:1290297-1290319 GCGTGGGGTCTCTGGCGCCCAGG + Intronic
968983916 4:3865255-3865277 GCGTGGGGAGGGGGCCGTCATGG + Intergenic
969203320 4:5622838-5622860 GCGTCTGGACCAGGCCGCCCTGG - Exonic
969436658 4:7192809-7192831 GCGTGAGGACCCAGGCGCCCGGG - Exonic
985778434 5:1857286-1857308 CCGTGGGGACCCGGCTGCTCAGG - Intergenic
985780990 5:1871724-1871746 GTGTTGGCACGCGGGCGCCCTGG - Intergenic
990581804 5:57173510-57173532 GCGCCGGGAAGCGGCCGCGCAGG - Intergenic
992228649 5:74641973-74641995 GCTTGGGGACGCGGGGACCCGGG - Intronic
993901787 5:93588709-93588731 ACGTGGGGCCGCGGCTGCCGAGG + Intronic
996329320 5:122311956-122311978 GCCTGAGGGCGCGGCGGCCCCGG + Intronic
996329354 5:122312059-122312081 GCTTCGGGCCGCGGCCGCCCAGG + Exonic
998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG + Intronic
998849204 5:146338294-146338316 GCGTGGGGAGGAAGCCACCCCGG + Intronic
1001125305 5:169013682-169013704 GCATGGGGCCCCGGCTGCCCTGG - Intronic
1001808507 5:174609263-174609285 GCCTGGTGCCGCGGCCTCCCGGG + Intergenic
1002043662 5:176530689-176530711 GCGTGGGGACCAGCCCTCCCTGG - Exonic
1002139932 5:177132574-177132596 GGCTGGGGACTCGGCCTCCCTGG + Intergenic
1002927209 6:1611446-1611468 GCGCGAGGACGCGGCCGCCGAGG - Exonic
1003139061 6:3456454-3456476 GCCCGGGGACGCGGCGGCCTCGG - Exonic
1003402185 6:5799782-5799804 CCATGGGGATGCGGCTGCCCAGG - Intergenic
1004262106 6:14117627-14117649 GGGCGGGGACGGGGGCGCCCCGG + Exonic
1005960090 6:30687867-30687889 GAATGGGGACCCGGCCGCTCTGG + Exonic
1006472568 6:34236962-34236984 GCGTGAGTTCGCGGCCGCTCCGG + Exonic
1007751320 6:44073573-44073595 GGGAGGGGCCGCGGCGGCCCTGG + Intergenic
1011434534 6:87322684-87322706 GCGTGATGGTGCGGCCGCCCTGG - Intronic
1013007388 6:106086420-106086442 GAGCTGGGACGCGGGCGCCCGGG + Exonic
1014632504 6:123803790-123803812 GCGTCGGGCGGCGGCCGCGCTGG + Intergenic
1016982323 6:149864397-149864419 GCGCGGGGGCGGGGCCGCGCGGG - Intergenic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019198383 6:170295675-170295697 GCGCCGGGACCCGGCCGCACCGG - Intronic
1019492335 7:1321313-1321335 GCCTGGGGAGGGGGCCTCCCTGG + Intergenic
1019513777 7:1430856-1430878 GCGTGAGCACACGGCCACCCTGG - Intronic
1019545008 7:1569961-1569983 TACTGGGGACGCAGCCGCCCGGG + Exonic
1019712770 7:2525009-2525031 GGGCGGGGGCGGGGCCGCCCTGG + Intronic
1020034842 7:4958764-4958786 GCGAGGAGGCGCGGGCGCCCCGG + Intronic
1022375516 7:29807458-29807480 GGGCGGGCACCCGGCCGCCCTGG + Intronic
1023177636 7:37448773-37448795 GCGTGGGGCCGCGGCGGCGTGGG + Exonic
1023810412 7:43906763-43906785 GGGTGGGGGCGGGGCGGCCCAGG + Exonic
1026009981 7:66629009-66629031 GCGGGCGGAGGCGGCGGCCCCGG - Exonic
1029283024 7:99448950-99448972 GCGTGGAGAAGCGGGAGCCCGGG + Intronic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1032119354 7:129145105-129145127 GCGGGGGGACCCCGCCGCCCAGG - Intronic
1033299848 7:140176435-140176457 GCGAGGGGACGCGGCCGGGCGGG - Intronic
1034418723 7:150978182-150978204 GCGCGGGGACGCGGCGGAGCGGG - Exonic
1036561399 8:9903098-9903120 GCGTGGGGAGGGGGTCGCCTGGG - Intergenic
1036802575 8:11803094-11803116 CCGGGTGGACGCGGCCGTCCTGG + Intronic
1037297141 8:17413315-17413337 GCGTGAGGCCGCGCCCGCCCGGG - Exonic
1037815470 8:22109522-22109544 CCGAGGGGGCGGGGCCGCCCGGG + Intergenic
1037928861 8:22865588-22865610 GCGGGGGGCCGCGTGCGCCCGGG - Intronic
1038883430 8:31639333-31639355 GCGCGGGGACGGGGACGCCCAGG + Intergenic
1049017835 8:139933556-139933578 GCGTGGAGAAGCGGCCGCGGTGG - Exonic
1049180768 8:141220895-141220917 GTGTGGGGGTGCGGCTGCCCTGG - Intronic
1049228176 8:141467595-141467617 AAGTGGGGAGGCGGACGCCCAGG - Intergenic
1049419584 8:142510862-142510884 CGGCGGGGACGCGGGCGCCCCGG - Intronic
1051418619 9:16870135-16870157 GCGCTGGGGCGCAGCCGCCCGGG - Intronic
1052048362 9:23820969-23820991 GTGTAGGGCCGCGGGCGCCCAGG - Intronic
1052824661 9:33166531-33166553 GCGTGGGGCCGGGACCGCACAGG - Intronic
1053312355 9:37027695-37027717 GCGTGTGGACAGCGCCGCCCGGG + Intronic
1056163525 9:83921218-83921240 GCTTGGGGTCGGGGCCGCCGCGG - Intronic
1056697296 9:88870795-88870817 TCGTGGGGAGGCAGCAGCCCTGG + Intergenic
1057773086 9:97984207-97984229 GCGCCGGGCCGCGCCCGCCCAGG - Intronic
1057900375 9:98943780-98943802 GCGTGGGGAGGCGGCCGGGGCGG + Exonic
1058908280 9:109498425-109498447 GCGTCGGGGCGCGCCAGCCCGGG - Intergenic
1059234497 9:112750689-112750711 CCGAGGCGCCGCGGCCGCCCGGG - Intergenic
1061347980 9:130042574-130042596 GCGTGGGGGCGTGGAGGCCCCGG - Intronic
1061609889 9:131739565-131739587 GCGGGGGGAAGCGGCCGCTGCGG - Intronic
1061991268 9:134160016-134160038 GGGTGGGAGGGCGGCCGCCCTGG + Intergenic
1062362354 9:136193871-136193893 GGGAGGGGGCGCGGCCGCCGGGG - Intergenic
1062494193 9:136823909-136823931 GAGTGGGCACGCGGGCGCCTCGG + Intronic
1062615674 9:137394705-137394727 GAGCGGGGATGCGGCCTCCCCGG + Intronic
1203773929 EBV:62490-62512 GCGCCGGTACGCGGCCGCCAGGG + Intergenic
1189325231 X:40107638-40107660 GCCTGGGGACGCGGCCGACTTGG + Intronic
1190096234 X:47483052-47483074 GCGCGGGGTCCCGGCCGCCGCGG - Intergenic
1190265738 X:48826521-48826543 CCGTGGGGAGGCGGGCGCGCTGG - Intergenic
1190745622 X:53320524-53320546 GCGTGGGGCCGCGGCCACCGCGG - Exonic
1191972624 X:66833482-66833504 GCCTGGGGACTTGGCTGCCCTGG + Intergenic
1192491033 X:71577911-71577933 GCGGGGGGACGCGGGAGCGCAGG - Intergenic
1193148742 X:78103857-78103879 GCGCAGGGACGCGGCTGCTCTGG + Intronic
1198099947 X:133414974-133414996 AGGTGGGAACGCGTCCGCCCCGG - Exonic