ID: 998178083

View in Genome Browser
Species Human (GRCh38)
Location 5:139914275-139914297
Sequence GTGGGAGTATGGCGGTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998178074_998178083 22 Left 998178074 5:139914230-139914252 CCAATTAGCAGAAAGGTCTGGAG 0: 1
1: 0
2: 0
3: 14
4: 147
Right 998178083 5:139914275-139914297 GTGGGAGTATGGCGGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998178083 Original CRISPR GTGGGAGTATGGCGGTCAGA AGG Intronic
No off target data available for this crispr