ID: 998179711

View in Genome Browser
Species Human (GRCh38)
Location 5:139927988-139928010
Sequence GGGGCTTTTTCTAGAGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998179711 Original CRISPR GGGGCTTTTTCTAGAGTAAG AGG (reversed) Intronic