ID: 998181814

View in Genome Browser
Species Human (GRCh38)
Location 5:139951397-139951419
Sequence GGACATAGTGGATCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998181808_998181814 9 Left 998181808 5:139951365-139951387 CCCAGGGCAGTCAAATGCTGGTG 0: 1
1: 0
2: 0
3: 12
4: 150
Right 998181814 5:139951397-139951419 GGACATAGTGGATCACAGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 152
998181809_998181814 8 Left 998181809 5:139951366-139951388 CCAGGGCAGTCAAATGCTGGTGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 998181814 5:139951397-139951419 GGACATAGTGGATCACAGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 152
998181806_998181814 22 Left 998181806 5:139951352-139951374 CCTGCTCTTCAAGCCCAGGGCAG 0: 1
1: 0
2: 1
3: 40
4: 304
Right 998181814 5:139951397-139951419 GGACATAGTGGATCACAGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998181814 Original CRISPR GGACATAGTGGATCACAGCC AGG Intronic
902411167 1:16212386-16212408 GGCCATAGTGGGTCAGAGCCAGG + Intronic
904497566 1:30895748-30895770 GGCCCTGGTGGGTCACAGCCAGG + Intronic
905190876 1:36233542-36233564 GGGCACAGTGGCTCATAGCCTGG + Intronic
905409653 1:37759715-37759737 GATCATAGTGCATTACAGCCTGG - Intronic
905437156 1:37964719-37964741 GCACATAGAGGACCACCGCCAGG - Intronic
905437353 1:37966321-37966343 GCACATAGAGGACCACCGCCAGG - Intronic
913600596 1:120417894-120417916 GTAAAAAGTGAATCACAGCCGGG - Intergenic
914590263 1:149100636-149100658 GTAAAAAGTGAATCACAGCCGGG + Intronic
917174469 1:172217670-172217692 GGAGAGAGTGGAGCACTGCCTGG - Intronic
920289198 1:204905148-204905170 AGTCATAGTGCATCATAGCCTGG + Intronic
923314160 1:232763347-232763369 GGAGATAGTGGATTAAAGCAAGG - Intergenic
924647399 1:245891453-245891475 GGACAAAGTGGATGTCATCCTGG - Intronic
1063449983 10:6144857-6144879 GGACATATTTGGTCAAAGCCTGG - Intergenic
1063999099 10:11648460-11648482 AGACTTGGTTGATCACAGCCGGG - Intergenic
1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG + Intronic
1064991495 10:21260582-21260604 GAACATAGTGATTCAGAGCCTGG - Intergenic
1067078442 10:43201036-43201058 GGACAAAGTGGGGCACAGCATGG + Intronic
1067129502 10:43549280-43549302 TGAAAAAGTGGATCTCAGCCAGG - Intergenic
1069803830 10:71104472-71104494 AGCCATATTGGATTACAGCCAGG + Intergenic
1073275066 10:102302793-102302815 GTATCTAGTGGATCAAAGCCAGG + Intronic
1074185983 10:111099760-111099782 GGACACTGTGTGTCACAGCCTGG - Intergenic
1082288303 11:50340142-50340164 GGACACTGTGGATGTCAGCCTGG + Intergenic
1082998092 11:59268498-59268520 GGAGATAGGAGAACACAGCCTGG - Intergenic
1083051365 11:59779744-59779766 GGGCATAGTGCAGCAGAGCCTGG + Intronic
1083087949 11:60169402-60169424 AGACAGAGTGGCTCAAAGCCAGG + Intergenic
1083487733 11:62994049-62994071 GGAAATAGAGGATCAGAGGCAGG - Intronic
1085389491 11:76175277-76175299 GCACAGAGCGGATCACAGTCTGG + Intergenic
1088648933 11:111940368-111940390 GGAAATGGGGGATGACAGCCAGG - Intronic
1090498267 11:127235786-127235808 TGACATAGTGGTTCTCAGCTGGG - Intergenic
1090510763 11:127372334-127372356 AAACATAGATGATCACAGCCAGG - Intergenic
1091800179 12:3320140-3320162 GGTCATGGTGGATCAGAGCATGG + Intergenic
1095147863 12:38752215-38752237 GGATTTAGTGGATGACAGCAAGG + Intronic
1097624877 12:61988031-61988053 GGATACAGTGGATAACAGCCAGG + Intronic
1103534548 12:121626027-121626049 GGACAAAGTGGTTAACAGACAGG + Intergenic
1106546513 13:30735394-30735416 GGACACACTGAACCACAGCCAGG + Intronic
1108707808 13:53005958-53005980 GGTCTGAGCGGATCACAGCCAGG + Intergenic
1113397051 13:109957675-109957697 GGAGCTAGAGGATCACATCCAGG + Intergenic
1117376286 14:55121049-55121071 GGGCATTGTGGTTCACAGCATGG + Intergenic
1118505879 14:66411341-66411363 TGACATAGTAGATCATAGCAAGG + Intergenic
1120157422 14:81109111-81109133 TGCCAAAGTGGATCACAGGCCGG + Intronic
1123126978 14:105953836-105953858 GGCTGTAGTGGAGCACAGCCAGG + Intergenic
1123130742 14:105983495-105983517 GGAGAGAGTGGATCACAGGGTGG - Intergenic
1123407442 15:20029656-20029678 GGCTGTAGTGGAGCACAGCCAGG + Intergenic
1123416011 15:20096055-20096077 GAACACAGTGGTTCAGAGCCTGG - Intergenic
1123516769 15:21036312-21036334 GGCTGTAGTGGAGCACAGCCAGG + Intergenic
1123525350 15:21103164-21103186 GAACACAGTGGTTCAGAGCCTGG - Intergenic
1123580973 15:21714717-21714739 GGAGAGAGTGGATCACAGGGTGG - Intergenic
1123617622 15:22157340-22157362 GGAGAGAGTGGATCACAGGGTGG - Intergenic
1123964873 15:25444884-25444906 AGTCACAGTGGGTCACAGCCTGG + Intergenic
1127289397 15:57556860-57556882 GGACACTGTGGAGCAGAGCCAGG + Intergenic
1128133528 15:65246290-65246312 GGAGATAGTGCCTCTCAGCCAGG - Intronic
1128357998 15:66941922-66941944 GGACAGCATGGAGCACAGCCAGG - Intergenic
1130642022 15:85685757-85685779 GGGCACGGTGGATCACACCCAGG - Intronic
1133067082 16:3215949-3215971 GGTCATAGGCCATCACAGCCAGG - Intergenic
1133740395 16:8646930-8646952 GGACATAGAGGATGACAGGAAGG - Exonic
1135964781 16:27026814-27026836 GTACAAAGTGCATGACAGCCCGG - Intergenic
1136130417 16:28217124-28217146 GGACACAGTGGAAGACAGCTTGG - Intergenic
1139472785 16:67187181-67187203 GGACATGGGGGATCAGAGGCTGG - Intronic
1141365444 16:83438292-83438314 GGACATTTTGGATCACAGGGTGG + Intronic
1148739849 17:49886554-49886576 GGAGAGAGTGGATCTCAGCCTGG - Intergenic
1151953292 17:77367165-77367187 AGACTTAGTGGTCCACAGCCTGG + Intronic
1152168349 17:78725668-78725690 CGACAGAGTGGATCACAGCCGGG + Intronic
1152420402 17:80189761-80189783 GGACATTCTGGAGCAGAGCCTGG + Exonic
1152487037 17:80601261-80601283 GGACATTGTGGAGCAGAGACAGG + Intronic
1152643964 17:81460426-81460448 GGACACAGTGGAGCCCAGGCAGG - Intronic
1158183551 18:54745251-54745273 TGACATGGTGGATGCCAGCCTGG + Intronic
1162449675 19:10747335-10747357 GGAAATACTGGATTCCAGCCAGG + Intronic
1163074361 19:14875986-14876008 GAACCTAGTGGATTAAAGCCAGG + Intergenic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1166701469 19:44884582-44884604 GGACACAGTGGGTCACAGCATGG - Intronic
1167045273 19:47045772-47045794 GGACAGAGGAGCTCACAGCCCGG - Exonic
1167687151 19:50963455-50963477 AGTCAGGGTGGATCACAGCCCGG + Exonic
927231388 2:20827420-20827442 GGACAGAGTGGCTCACACCTAGG - Intergenic
930009844 2:46928334-46928356 GGACATAGTTGATCCTGGCCTGG - Intronic
930930305 2:56874616-56874638 GTCTATAGTGGAGCACAGCCAGG + Intergenic
932007450 2:67940781-67940803 GGCCCTTGAGGATCACAGCCTGG + Intergenic
933771874 2:85749779-85749801 GGACACAGTGGTTCAGAGCTTGG + Intergenic
935204163 2:100883236-100883258 GGCCTTGGTGGATCTCAGCCAGG - Intronic
937516397 2:122660822-122660844 GGACAGAGAGGACCGCAGCCTGG - Intergenic
937939569 2:127274617-127274639 GGACATTCTGGATCACGGCAAGG - Intronic
938040694 2:128073636-128073658 GGACATAGTGGCTAACACCTGGG + Intergenic
939950496 2:148466873-148466895 TGAGATAGTGGATCTCAACCTGG - Intronic
943015996 2:182511584-182511606 AGCTATAGTGGAGCACAGCCAGG + Intronic
943838868 2:192552187-192552209 GGAAATACTGGATCACAGGTGGG + Intergenic
944311383 2:198237414-198237436 GATCATAGTGCACCACAGCCTGG + Intronic
944358372 2:198821060-198821082 GGAAATAGAGGATCAGAGCTGGG - Intergenic
947701773 2:232240383-232240405 AGACAGAGTTGATCAGAGCCAGG + Intronic
948706037 2:239792980-239793002 GGATAAAGTGGAGCCCAGCCTGG - Intronic
1170140424 20:13120800-13120822 GGAAAGTGGGGATCACAGCCTGG - Intronic
1172782614 20:37446213-37446235 GGACATAACAGATCATAGCCTGG - Intergenic
1174412516 20:50345201-50345223 TGACATATGGGAACACAGCCTGG + Intergenic
1175231492 20:57476407-57476429 GGAAACAGAGGAACACAGCCCGG - Intergenic
1175698934 20:61123516-61123538 GGAGACAGTGGATCACATCAAGG + Intergenic
1181928341 22:26378385-26378407 GGCCAAAGTGGCACACAGCCAGG + Intronic
1182543680 22:31059945-31059967 GAACACAGTGGTTCAGAGCCTGG + Intergenic
1183768694 22:39904092-39904114 GGAGATAGTGAAGAACAGCCGGG + Intronic
949288896 3:2439796-2439818 GGAAATGGAGGATCACAACCAGG - Intronic
949586014 3:5438058-5438080 GGAGATTGAGGCTCACAGCCAGG - Intergenic
950958248 3:17078150-17078172 GGACAAAGTGGATTAAAGCAGGG - Intronic
953366903 3:42352851-42352873 GGACATAGTTGCTCACAGCAAGG + Intergenic
955213492 3:56963816-56963838 GGACATAGTTGATGAGAGACTGG + Intronic
955698469 3:61659798-61659820 GGAAATTGTGTATCACATCCAGG - Intronic
960135325 3:114098486-114098508 GGGCACAGTGGCTCATAGCCAGG + Intergenic
960234326 3:115264119-115264141 GGAGAGAGGGGACCACAGCCAGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961312663 3:126013599-126013621 GGACAGAGATGATCACAGGCAGG + Intronic
962825434 3:139096303-139096325 GGACACAGAGGGGCACAGCCTGG + Intronic
965307955 3:167091597-167091619 GGATATGGTGAATCACAGCTGGG - Intergenic
967411436 3:189170116-189170138 AGACATGCTGGATCCCAGCCTGG - Intronic
969501042 4:7553160-7553182 GGACCTTGTGGATCTCAGGCTGG - Intronic
969662396 4:8537924-8537946 GGTCATTGTGGATCAGACCCCGG + Intergenic
969893945 4:10285479-10285501 GCACAAAGGGGATCAGAGCCTGG - Intergenic
971556181 4:28014777-28014799 GAAAATAGTGGCTCAAAGCCAGG + Intergenic
972072425 4:35038414-35038436 GGGCAGAGTGGATCACTCCCCGG - Intergenic
977519737 4:98066327-98066349 GGACATTGTGGCTCACAACTGGG + Intronic
980931724 4:139188637-139188659 GGGCATAGTGGCTCATGGCCGGG + Intergenic
981466239 4:145075835-145075857 GGCTACAGTGGAGCACAGCCAGG + Intronic
981847114 4:149182190-149182212 GGATAGAGAGGCTCACAGCCAGG + Intergenic
982398544 4:154940311-154940333 GGTCACAGTGGAATACAGCCTGG - Intergenic
993944043 5:94097075-94097097 GGCTACAGTGGAGCACAGCCAGG + Intronic
996045872 5:118873190-118873212 GTCTATAGTGGAGCACAGCCCGG + Intronic
997249883 5:132380337-132380359 GGGCTTAGTGGATCACAGTTAGG + Intronic
998181814 5:139951397-139951419 GGACATAGTGGATCACAGCCAGG + Intronic
1002383209 5:178845416-178845438 GTACATAGTGGCTCACACCATGG + Intergenic
1011988258 6:93478044-93478066 GGACATAATGGATCACAAACAGG - Intergenic
1013401483 6:109800974-109800996 GAATATAGTGAATCACTGCCTGG - Intronic
1013586170 6:111581079-111581101 GGAGAAAGTGGGTCCCAGCCAGG + Intronic
1017239103 6:152147475-152147497 GGACAAAGTGGAGAAGAGCCTGG - Intronic
1017796345 6:157848161-157848183 GGACATAGTGGTGAAAAGCCAGG - Intronic
1020185821 7:5958613-5958635 GGACAAAGTGGGTAAGAGCCGGG + Intronic
1020297095 7:6766149-6766171 GGACAAAGTGGGTAAGAGCCGGG - Intronic
1024465340 7:49706293-49706315 GGACATTGTGGTTCACTGCCGGG - Intergenic
1026088898 7:67283927-67283949 GGTCATAGTGTATTTCAGCCGGG + Intergenic
1026725356 7:72866420-72866442 GGTCATAGTGTATTTCAGCCGGG - Intergenic
1026856735 7:73759995-73760017 GGGCGTGGTGGCTCACAGCCAGG - Intergenic
1027545106 7:79517773-79517795 GAACATAGTGGATCGCATGCTGG + Intergenic
1028639684 7:93028881-93028903 GTCTATAGTGGAGCACAGCCAGG + Intergenic
1031839452 7:126719672-126719694 AAAACTAGTGGATCACAGCCTGG - Intronic
1033501048 7:141950091-141950113 GGTCATAGTGGAACTCAGACTGG - Intronic
1034169780 7:149054112-149054134 CCACATACTGGGTCACAGCCTGG + Intergenic
1038697618 8:29819866-29819888 GGAGAGAGCGGAGCACAGCCCGG - Intergenic
1039224935 8:35378144-35378166 GGAGATAGGGGATCGCAGTCAGG - Intronic
1041165207 8:55085252-55085274 GCACATAGTGGATCACAAAGTGG - Intergenic
1042976812 8:74478680-74478702 GGCTACAGTGGAGCACAGCCAGG - Intronic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1048744059 8:137593509-137593531 GGAGATAGTGTATCACAGAGTGG - Intergenic
1055429103 9:76226113-76226135 AGACATAGAGGAACAGAGCCCGG + Intronic
1058407655 9:104694859-104694881 GGTCATAGGCCATCACAGCCAGG - Exonic
1058410137 9:104722676-104722698 GGTCATAGGCCATCACAGCCAGG - Intergenic
1060047513 9:120352248-120352270 GGACATTGTTCATCACAGCTGGG + Intergenic
1060216253 9:121740210-121740232 TGACCCAGTGGATCTCAGCCTGG + Intronic
1186219739 X:7336844-7336866 GAACATATTGGATCAGAGGCTGG + Intronic
1186509315 X:10118558-10118580 CAGCATAGTGGATCTCAGCCAGG + Intronic
1186723054 X:12326545-12326567 GGACTTGGTGGCTCTCAGCCAGG - Intronic
1187922141 X:24215205-24215227 GGACTTGTTGGATCACAGACAGG - Exonic
1188172125 X:26940473-26940495 GCACAAAGTGGATTATAGCCAGG + Intergenic
1190562263 X:51697147-51697169 GTACTGAGTGGATCACACCCAGG + Intergenic
1190741572 X:53292216-53292238 GGGCCTAGTGGATCACAGTGAGG + Intronic
1199912996 X:152307946-152307968 GGCTACAGTGGAGCACAGCCAGG + Intronic
1200164486 X:154026777-154026799 GGAGATACTTGGTCACAGCCAGG - Intronic
1200226463 X:154420380-154420402 GGACAGAGTGGAACATAGACAGG + Intronic
1201589182 Y:15594976-15594998 GAACATATTGGATCAGAGGCTGG + Intergenic