ID: 998187557

View in Genome Browser
Species Human (GRCh38)
Location 5:139993534-139993556
Sequence GATGTGAGACTATTTTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998187557_998187558 7 Left 998187557 5:139993534-139993556 CCAATCTAAAATAGTCTCACATC 0: 1
1: 0
2: 1
3: 12
4: 162
Right 998187558 5:139993564-139993586 TAATAACCCTTATCAGTATCTGG 0: 1
1: 0
2: 1
3: 10
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998187557 Original CRISPR GATGTGAGACTATTTTAGAT TGG (reversed) Intronic
903784896 1:25853871-25853893 GGTGTGTGACTTTTTCAGATTGG - Intronic
904802459 1:33103513-33103535 GAGGTGAGCCTACTTTAGAGAGG - Intronic
905505206 1:38473935-38473957 GAACTGATACTTTTTTAGATTGG - Intergenic
906138905 1:43521650-43521672 GATGGAAAACTATTTTAGATAGG + Intergenic
906159101 1:43634550-43634572 GATGTGAGACTAATTGAGCAAGG - Intergenic
907932048 1:59009593-59009615 GATGAGAGAATTCTTTAGATTGG - Intergenic
911586981 1:99702864-99702886 AATGTGAAACTATTTTAAAGTGG + Intergenic
911905457 1:103562739-103562761 AATGTGAGGCTACTTTGGATAGG + Intronic
912187958 1:107303130-107303152 AATATGAGATTATTTTATATTGG - Intronic
915799532 1:158774810-158774832 GATGTGAGACAAGTTGAGGTGGG + Intergenic
919217745 1:194581971-194581993 AAAGTGAGACTGTTTTATATTGG + Intergenic
920745334 1:208622236-208622258 CATGTGTGACTATTGTAGATGGG - Intergenic
921617822 1:217292268-217292290 GAGGAAAGAATATTTTAGATAGG - Intergenic
1063245686 10:4215848-4215870 GATGTTAAAATATTTAAGATTGG + Intergenic
1065642202 10:27794744-27794766 GGTATTAGACTATTTTAGCTGGG + Intergenic
1069362995 10:67665116-67665138 GATGTAAGACTACTATAGCTTGG + Intronic
1074568004 10:114598716-114598738 GAAATGATAATATTTTAGATAGG + Intronic
1074927684 10:118090693-118090715 CATGGAAGGCTATTTTAGATTGG + Intergenic
1077700615 11:4438655-4438677 CATGGGACACAATTTTAGATAGG + Intergenic
1079228418 11:18628223-18628245 GATCTGAGAATCTTTTATATAGG - Intronic
1079333960 11:19555090-19555112 GATATGTGACTATCTTAGATTGG + Intronic
1080578011 11:33617576-33617598 GATGGGAGACAACTTTAGATAGG - Intronic
1081018910 11:37918396-37918418 GGAGTGAGGCTATTTTAAATAGG - Intergenic
1083590502 11:63890992-63891014 GAGGTGAGACTATTACAAATGGG - Intronic
1086792497 11:91060163-91060185 GATATTAGACTTTTGTAGATGGG - Intergenic
1087855572 11:103088135-103088157 AATGTGAGACTATTTTGAAAGGG - Intronic
1088553919 11:111042417-111042439 AATGAGAGACTTTTATAGATAGG - Intergenic
1092642757 12:10534835-10534857 GCTATGAGACTATTATACATGGG - Intergenic
1095656818 12:44679794-44679816 GATGTGACTCCAATTTAGATTGG - Intronic
1096712269 12:53466015-53466037 GGAGTGAGACAATTTTGGATGGG - Intronic
1097623242 12:61967078-61967100 GATGAGAGACTATATTACAGGGG + Intronic
1100244561 12:92743991-92744013 GATGTGAGTTTATTTTGGAGGGG - Intronic
1100652541 12:96606149-96606171 GAGCTGAGCCTATTTTAGACGGG + Intronic
1102840894 12:116120123-116120145 GATGTGAGGAAATTTTAGATTGG - Intronic
1104222871 12:126802650-126802672 AATGTGAGCCTATTTTTTATTGG + Intergenic
1106222921 13:27761930-27761952 GAGGGGAGACTGTTTCAGATGGG - Intergenic
1107152063 13:37123267-37123289 TGTGTGTGACTATTTTAAATGGG + Intergenic
1108150176 13:47525201-47525223 TATGTGAGCCTAGTTTATATTGG - Intergenic
1108800788 13:54092470-54092492 GAAGTCAGACTATTTTCCATGGG - Intergenic
1111479231 13:88800416-88800438 TATGTGTGGCTATTTTAAATGGG + Intergenic
1112716928 13:102197788-102197810 GATCTAAAACTATTTTGGATGGG - Intronic
1113163152 13:107406406-107406428 TATGTGTAACTATTTTAAATGGG - Intronic
1113562758 13:111296233-111296255 GATGTGTGACTATTTGGGGTGGG + Intronic
1114128562 14:19760907-19760929 AATTTGAGGCTATTTTAGACAGG + Intronic
1114161506 14:20173305-20173327 GATGTAAGACATTTTCAGATGGG - Intergenic
1114984804 14:28212835-28212857 TATGTGTGGCTATTTTAAATGGG + Intergenic
1116263396 14:42659557-42659579 CATGTGAGACCATCTTAGCTTGG - Intergenic
1118097696 14:62557182-62557204 GAGGAGAGACTATTTTATATAGG + Intergenic
1118252065 14:64171498-64171520 GATGTGTGGCTCCTTTAGATTGG + Intronic
1120369822 14:83618910-83618932 TATGTGAGACCACTGTAGATAGG - Intergenic
1120779153 14:88470454-88470476 GAGGTGAGACTATCTTAAGTAGG - Intronic
1122679481 14:103447061-103447083 AATGAGACAGTATTTTAGATAGG + Intronic
1123571504 15:21615168-21615190 AATTTGAGGCTATTTTAGACGGG + Intergenic
1123608123 15:22057759-22057781 AATTTGAGGCTATTTTAGACGGG + Intergenic
1125455637 15:39856218-39856240 GGTGTGTGGCTATTTTGGATAGG - Intronic
1125624713 15:41098230-41098252 GAAGTTACACTGTTTTAGATAGG - Intronic
1126503689 15:49378556-49378578 TATGTGTGACTATTGTAAATGGG + Intronic
1129962026 15:79695819-79695841 GATGTCAGACTATCTGGGATTGG - Intergenic
1131935176 15:97496297-97496319 TAAGTAAGATTATTTTAGATAGG + Intergenic
1202980358 15_KI270727v1_random:349557-349579 AATTTGAGGCTATTTTAGACGGG + Intergenic
1133521951 16:6567187-6567209 GCAGTCAGACTATTTTAAATGGG + Intronic
1139564757 16:67767199-67767221 GATCTGAGTCTCTTTGAGATGGG - Intronic
1143528466 17:7485858-7485880 GAGGTGGGGCTACTTTAGATGGG + Intronic
1145716164 17:27024147-27024169 GATGTAAGACATTTTCAGATGGG - Intergenic
1146177063 17:30672198-30672220 GCTGTGAGTCTAATTTACATAGG + Intergenic
1146191934 17:30776377-30776399 CATGGGAGACTATTCTTGATGGG + Intronic
1146222715 17:31038713-31038735 GCTGTGAGTCTAATTTACATAGG + Intergenic
1146337109 17:31983079-31983101 CATGGGAGACTATTCTTGATGGG + Exonic
1146342280 17:32031297-32031319 GCTGTGAGTCTAATTTACATAGG - Intronic
1146350529 17:32088299-32088321 GCTGTGAGTCTAATTTACATAGG + Intergenic
1147463358 17:40590189-40590211 GAGGTGAGAGTATTTGAGCTGGG - Intergenic
1148688008 17:49511592-49511614 CATGTGGGAGTATTTTAGAAGGG + Intronic
1149109913 17:53016198-53016220 GATGTGAATATATTTTAAATGGG - Intergenic
1150783720 17:68144936-68144958 GCTGTGAGTCTAATTTATATAGG + Intergenic
1153594859 18:6715181-6715203 GATTTGTGACTATATTAGAAAGG - Intergenic
1155751575 18:29429355-29429377 GAAGAGAAACTATTTAAGATTGG + Intergenic
1156966186 18:43096073-43096095 AAAGTGAGACTATTTCACATTGG + Intronic
1157922748 18:51730647-51730669 GAGGAGAGATCATTTTAGATCGG + Intergenic
1158163334 18:54510618-54510640 TATGTGTGGCTATTTTAAATGGG - Intergenic
1158268562 18:55687282-55687304 GATGTGAGATGATTCGAGATGGG - Intergenic
1164405373 19:27940168-27940190 TATTTGAGACAATTTTATATTGG + Intergenic
1164491294 19:28717182-28717204 TATGTGTAACTATTTTAAATGGG - Intergenic
1168022310 19:53618369-53618391 GATGGTAGATTATTTCAGATAGG + Intergenic
1168277751 19:55286562-55286584 AATGTGAGACTATATTCGTTGGG + Intronic
925423831 2:3732687-3732709 GATGTCAGACTGTGTTAAATTGG + Intronic
929486010 2:42355434-42355456 AATGTGAGAGTATTTTTGAAGGG + Intronic
932616826 2:73237283-73237305 GCAGAGTGACTATTTTAGATGGG + Intronic
932967983 2:76500899-76500921 GATGGGAGACAATTTTCCATGGG - Intergenic
933011086 2:77064523-77064545 GATGTGAAATTATTTTTGACAGG - Intronic
934025935 2:88001667-88001689 GATCTGAGAAGATTTTACATTGG - Intergenic
939764677 2:146231919-146231941 GATGTAAGAATATTTTAAAATGG - Intergenic
940429409 2:153571207-153571229 TATGTGTGGCTATTTTAAATGGG + Intergenic
942070917 2:172314550-172314572 GATATAACACTATTTTAGCTAGG + Intergenic
942758051 2:179365043-179365065 AATGTGACTCTATTTGAGATAGG + Intergenic
944095621 2:195964392-195964414 TATTTGAGACTATTGTAAATGGG + Intronic
944987966 2:205200798-205200820 GACGTGAAGGTATTTTAGATGGG + Intronic
944992944 2:205258425-205258447 GTTGGGTGACTATTTTAGATAGG - Intronic
945687389 2:212988160-212988182 GATGTTAGAGTATTTTAAAGTGG - Intergenic
946163461 2:217849657-217849679 GGGGTGAGACTTTTTGAGATGGG - Intronic
1170132622 20:13037699-13037721 GATGCGGAAATATTTTAGATGGG + Intronic
1174705477 20:52651311-52651333 GAAGTGTGACTATTTTCAATCGG + Intergenic
1176803007 21:13451230-13451252 GATGTAAGACATTTTCAGATGGG - Intergenic
949769371 3:7562395-7562417 TATTTGAGAGTATTTTAGAGGGG - Intronic
956324344 3:68034824-68034846 AATGTGATACTATTTTAGAAAGG + Intronic
959304246 3:104640504-104640526 TATGTGTGACTATTTTAGATGGG - Intergenic
962610934 3:137075661-137075683 GAAATGAGACAATTTTGGATGGG + Intergenic
963342763 3:144057179-144057201 GAAGTCAGACTATTCTTGATAGG + Intergenic
965567848 3:170140018-170140040 GATGTGAGAGTATTTTGGCAGGG - Intronic
965964798 3:174474147-174474169 GATGAGATGCTATTTTATATTGG - Intronic
966312559 3:178610503-178610525 TATGTGTGGCTATTTTAAATGGG + Intronic
966957374 3:184896846-184896868 AATGTGAGGCTACCTTAGATTGG + Intronic
967136462 3:186516706-186516728 GATGTGAAAATATTTTCCATTGG + Intergenic
970632925 4:17972863-17972885 GTTTTGAGAGTATTTTAGAAGGG - Exonic
970681408 4:18512765-18512787 GATTTGACACTATTTTATGTTGG - Intergenic
971679848 4:29683493-29683515 GGAGAGAGAATATTTTAGATTGG + Intergenic
973998761 4:56488245-56488267 GATCTGAGATTATTTGAGGTTGG - Intronic
975953928 4:79812841-79812863 GATGTTTGAATATTTTAAATTGG + Intergenic
976640878 4:87336485-87336507 GATGTGAGGCTCATTGAGATGGG - Intergenic
979413820 4:120411631-120411653 TATGTGTGGCTATTTTAAATGGG - Intergenic
980219421 4:129896382-129896404 GATTTTACACTGTTTTAGATGGG - Intergenic
981168354 4:141590118-141590140 AATGTGATAGTATTTTAGGTGGG + Intergenic
983389288 4:167107834-167107856 TATGTGTGGCTATTTTAAATGGG - Intronic
984521484 4:180807135-180807157 GAGGTAAGGCTATTTTAAATGGG - Intergenic
986071246 5:4286854-4286876 AATGTGAGAAGATTTTAAATGGG - Intergenic
991605789 5:68399429-68399451 TATGTGGGAATATTTTAGATAGG - Intergenic
996457326 5:123699648-123699670 GATGTGAGACTTTTCTAAAAGGG + Intergenic
998187557 5:139993534-139993556 GATGTGAGACTATTTTAGATTGG - Intronic
999416095 5:151397444-151397466 GATGTGGGAATATTTGAGAAGGG - Intergenic
1000586397 5:163104607-163104629 TATGTGAGCCTATTTTTTATTGG - Intergenic
1008662379 6:53681662-53681684 GATGTGAGAGTTTTTCAGCTTGG + Intergenic
1010493358 6:76501527-76501549 GATTTGAGACTATTCAGGATAGG - Intergenic
1010661840 6:78580601-78580623 GATTTGAGACTACTGTACATTGG + Intergenic
1012061107 6:94482380-94482402 GATGTAAAACTATTTTTGAAAGG - Intergenic
1014400114 6:120977854-120977876 AATGTGAGAATATTATAGAAGGG + Intergenic
1016515037 6:144883938-144883960 GATGTGATTGTATTTGAGATAGG + Intergenic
1020538879 7:9436167-9436189 GATTACAGAATATTTTAGATGGG - Intergenic
1029834853 7:103298014-103298036 GATGTGAGACTTTTGTATAAGGG + Intronic
1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG + Intronic
1032819679 7:135513130-135513152 GAGGGGAGCCTAATTTAGATTGG + Intergenic
1033007237 7:137579886-137579908 GCTGTAGGACTATTTTAGAGTGG - Intronic
1033327794 7:140393673-140393695 CAGGGGAGACCATTTTAGATAGG - Intronic
1034196435 7:149251807-149251829 TATTTAAGACTATTTGAGATGGG + Intronic
1034341767 7:150361781-150361803 GGTGTGAAGCTATTTTAGAGGGG + Intergenic
1036629972 8:10505530-10505552 GATGAGATGCTATTTTATATTGG + Intergenic
1037209560 8:16370134-16370156 GATGGATTACTATTTTAGATGGG - Intronic
1041875029 8:62677731-62677753 GAAGTGAGAGGATTTAAGATTGG - Intronic
1044819618 8:96146758-96146780 AAAGTGAGAGAATTTTAGATTGG - Intronic
1047425166 8:124738825-124738847 CATGGGAGACTATTTTTAATGGG + Intergenic
1047721671 8:127645949-127645971 GATTTTAGACTATTTCACATGGG - Intergenic
1048679889 8:136829548-136829570 GAGGTGAGAATACTTTAGGTTGG + Intergenic
1050363374 9:4852181-4852203 AATGTGAAACTCTTTTAGAAAGG + Intronic
1055116511 9:72611046-72611068 GATGTAAGAAGATTTTGGATGGG + Intronic
1055633309 9:78247270-78247292 CAGGTGGGACTATATTAGATAGG + Intronic
1055965095 9:81858487-81858509 GAGGGGATGCTATTTTAGATAGG + Intergenic
1058748154 9:108012272-108012294 GCTCTGAGACTATTCCAGATTGG - Intergenic
1059399128 9:114057899-114057921 GAGGTGAGACTATTTAAGAATGG + Intergenic
1060034490 9:120243155-120243177 TATCTGGGACTCTTTTAGATAGG - Intergenic
1186276649 X:7946445-7946467 TATGTGTGGCTATTTTAAATTGG + Intergenic
1186752939 X:12640549-12640571 TATGTAAGACTAATGTAGATTGG + Intronic
1190243181 X:48673631-48673653 GATGTGACTGTATTTGAGATAGG - Intergenic
1194061917 X:89214131-89214153 AATGTGTTACTATTTTATATTGG + Intergenic
1194278036 X:91912031-91912053 TATGTGTGACTATTGTAAATGGG + Intronic
1195136837 X:101916425-101916447 TATGTGTGACTATTGTAAATTGG - Intronic
1195171836 X:102276432-102276454 TATGTGTGGCTATTTTAAATGGG + Intergenic
1195187024 X:102410661-102410683 TATGTGTGGCTATTTTAAATGGG - Intronic
1195208981 X:102633136-102633158 GGAGGGATACTATTTTAGATAGG + Intergenic
1195635789 X:107114456-107114478 GATGTGAGACAAGGTTAGAAAGG - Intronic
1196297313 X:114013127-114013149 GATGTGATGCTATTTGAGATGGG + Intergenic
1197119445 X:122872832-122872854 GTTTTGAAACTATTTTAAATAGG - Intergenic
1197258993 X:124296322-124296344 GATTTGTTACTATTTTAGAAGGG - Intronic
1198190962 X:134305228-134305250 GATGTGATACCATTTTTGCTTGG - Intergenic
1198695251 X:139329762-139329784 TATGTGTGACTATTGTAAATGGG - Intergenic
1200595374 Y:5134106-5134128 TATGTGTGACTATTGTAAATGGG + Intronic
1200715845 Y:6543435-6543457 AATGTGTTACTATTTTATATTGG + Intergenic
1200906805 Y:8492096-8492118 GATGAGAGACTTTTTTTGAGGGG + Intergenic
1201524934 Y:14922257-14922279 AATATGAGTCTATTTTATATGGG - Intergenic