ID: 998188095

View in Genome Browser
Species Human (GRCh38)
Location 5:139998370-139998392
Sequence TCCAGGACTTTCTTGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998188095_998188102 2 Left 998188095 5:139998370-139998392 CCCAAGGCCAAGAAAGTCCTGGA 0: 1
1: 0
2: 3
3: 38
4: 259
Right 998188102 5:139998395-139998417 GCCGGCCACGTGACCATCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
998188095_998188105 12 Left 998188095 5:139998370-139998392 CCCAAGGCCAAGAAAGTCCTGGA 0: 1
1: 0
2: 3
3: 38
4: 259
Right 998188105 5:139998405-139998427 TGACCATCTCAGGTATACTCAGG 0: 1
1: 0
2: 0
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998188095 Original CRISPR TCCAGGACTTTCTTGGCCTT GGG (reversed) Intronic
900350073 1:2230126-2230148 CCCAGGTCTTTCTTGGGGTTGGG + Intronic
900767643 1:4515831-4515853 TCCAGGAGTTCCTTGGCTTGTGG - Intergenic
901125255 1:6924460-6924482 TCCACGACTTTCATCCCCTTGGG + Intronic
904399389 1:30245939-30245961 TCCTGCACATTCTGGGCCTTTGG - Intergenic
905650489 1:39653204-39653226 GCCAAGACTTTCTTGGCCAGAGG + Intergenic
905683582 1:39892451-39892473 TCTAGCATTTTCTTGACCTTGGG - Intergenic
906125148 1:43422984-43423006 TCCAGGTCTTCCTTGGTCTGGGG - Intronic
906451961 1:45957912-45957934 GCCAGGACTTTGGTGTCCTTGGG + Intronic
907505397 1:54914534-54914556 ACCTGGACATTCTTGTCCTTTGG - Intergenic
907678924 1:56545515-56545537 TCCAGGAACTTCTTGGGATTGGG + Intronic
907830558 1:58060648-58060670 GCCAGGACTTTGTGGGCCCTTGG - Intronic
908434132 1:64088496-64088518 TCCAGATCTTTCATGGCCATGGG - Intronic
909473846 1:76060049-76060071 TCTAGGACTTTCGTTGACTTGGG + Intergenic
909538372 1:76764043-76764065 TCCAGGAGTTTCTTGGCCTGTGG + Intergenic
910881916 1:91929488-91929510 TCCTGGTCTTTCTTGGCTTTTGG - Intergenic
911275377 1:95853076-95853098 TCCAGGTCCTCCTTGGGCTTGGG - Intergenic
912023731 1:105139708-105139730 TCCTGGTATTTCTTGGCCTGTGG - Intergenic
913536744 1:119780271-119780293 TCCAGGACTGGCTGGACCTTTGG + Intergenic
914216379 1:145633935-145633957 TCCAGGTCTTTCTTCCCCCTTGG - Intronic
914468952 1:147956594-147956616 TCCAGGTCTTTCTTCCCCCTTGG - Intronic
914913425 1:151803945-151803967 TCCAGTACTTCCTCTGCCTTGGG - Intronic
917954560 1:180080726-180080748 TCAAGGAGTTTGTTGACCTTAGG + Intronic
918093427 1:181316427-181316449 TTCAGGACTTACCTGGCCCTGGG + Intergenic
919178571 1:194052321-194052343 TACAGGCCTTGCTTGTCCTTTGG - Intergenic
920580005 1:207097471-207097493 TCCAGCACTTTCCAGGACTTTGG - Intronic
920696571 1:208185296-208185318 TGCAGCACTTTCTGGCCCTTGGG - Intronic
921270893 1:213468873-213468895 ACCAGGTCTTTCTTGACCCTGGG + Intergenic
923828806 1:237530422-237530444 TCCAGGACTTTGTTGGCATTAGG + Exonic
924723211 1:246643140-246643162 TCCAGGACTTTGTGGGGCTGAGG - Intronic
1063053372 10:2477080-2477102 TCCAGGGCTTGCTTGGCCATGGG + Intergenic
1065457179 10:25919030-25919052 TCCAGGACTGTCCTGGAATTGGG + Intergenic
1065834971 10:29648674-29648696 TGCAGGGCTTTCTTGGCCACAGG - Intronic
1066054707 10:31669908-31669930 TCCAGTGCTTTCTTGCCTTTGGG - Intergenic
1066445771 10:35481361-35481383 TCCAGGACATTCTTGGACTTAGG + Intronic
1066470881 10:35696933-35696955 TTCAGGATTTTCATGGTCTTAGG + Intergenic
1068777882 10:60887705-60887727 TCAAGGACTTTAGTGGCCTCAGG + Intronic
1069710171 10:70482986-70483008 TCCTGAGCTTTCTTGGCCCTGGG + Intronic
1069864590 10:71493932-71493954 TTCAGCACTTCCTTGGCCTGTGG + Intronic
1071669409 10:87594159-87594181 CCTAGGACTTTCTTAGCTTTTGG + Intergenic
1071679050 10:87685970-87685992 TCCAGTGCATTATTGGCCTTTGG + Intronic
1071696026 10:87872530-87872552 TGCAGGACTTTTTTGGCACTTGG + Intronic
1071757141 10:88555767-88555789 TCAAACACTTTCTTGGCCTATGG + Intronic
1072581647 10:96745106-96745128 TCCAGGAGTTCCTTGGCTTGTGG + Intergenic
1074215732 10:111381888-111381910 TCCAGGACTTTTATGGGCTCAGG + Intergenic
1074912902 10:117927775-117927797 TCCCGGACTTTCTTGTCCCTTGG + Intergenic
1076357252 10:129862078-129862100 TCCAGGGCTGTCCTGGCCCTGGG - Intronic
1076404209 10:130201521-130201543 CCCAGGACTTTCCTGGCTTGAGG - Intergenic
1078646695 11:13147350-13147372 TCATGTACTGTCTTGGCCTTAGG + Intergenic
1081084606 11:38784431-38784453 ATCAGGACTTTCTTGACCTCAGG + Intergenic
1083511542 11:63213424-63213446 TACTGGACCTTCATGGCCTTAGG + Intronic
1084702758 11:70798301-70798323 TTCAGGACTTTCTAGATCTTTGG - Intronic
1086426267 11:86686339-86686361 TCAAGGACTTAGTTGGCTTTAGG + Intergenic
1087104288 11:94394798-94394820 TCAAGGACTCTGCTGGCCTTGGG + Intronic
1087465136 11:98494908-98494930 TCCAGATGTCTCTTGGCCTTAGG + Intergenic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1089621789 11:119726867-119726889 TCTAGGACTTGCCTGGCCATGGG - Intronic
1089902553 11:122002679-122002701 GTCAGGACTGTCTTGCCCTTTGG + Intergenic
1090121083 11:124029057-124029079 GCTAGGACTTTCTTGGACCTAGG + Intergenic
1090912561 11:131134172-131134194 TCCAGGCATATCTTGGCCTGTGG + Intergenic
1091115238 11:133006365-133006387 TCCTGAATTTTCTTGGCCATGGG + Intronic
1091435295 12:467699-467721 CCCTGGTCTTCCTTGGCCTTAGG - Intronic
1091488777 12:915214-915236 TCCAGGCCTTTCCTGCCCCTTGG - Intronic
1091859395 12:3766212-3766234 TTCAGGATTTTCTTGGTCTTTGG - Intergenic
1093641267 12:21529169-21529191 CCCCAGAATTTCTTGGCCTTAGG + Intronic
1094629733 12:32161447-32161469 TCCAAGACTTTCTCGGCCAATGG - Intronic
1096125268 12:49114622-49114644 CTCAGGACTTTCTGGGTCTTTGG + Intergenic
1098216436 12:68225167-68225189 TGGAGGACTTTCATAGCCTTAGG - Exonic
1098854608 12:75638090-75638112 TCCAGGACTCCCTTGGCCAAGGG + Intergenic
1099273391 12:80543541-80543563 TCCAGGACTTCATTTGCCTTTGG - Intronic
1100576754 12:95899038-95899060 TCCAGTACTTTCTGGGAATTGGG + Intronic
1101159101 12:101955523-101955545 TCCTGGACTTTCTTTGCCCTTGG - Intronic
1102770390 12:115471021-115471043 TCCAGAACTTTCTTTAACTTAGG - Intergenic
1103166111 12:118772133-118772155 TCCAGGCATTTGTTGGCTTTTGG - Intergenic
1104096602 12:125563848-125563870 TCCAGGAGTTCCTTGGCTTCTGG - Intronic
1106564768 13:30874624-30874646 CTCAGGAGTTTCTGGGCCTTCGG + Intergenic
1106953893 13:34914377-34914399 TCCAGGAGTTTCTAGTCCATGGG + Intergenic
1107808884 13:44180390-44180412 TCCAGGCATTCCTTGGCTTTAGG + Intergenic
1108270375 13:48753656-48753678 TCAAAAATTTTCTTGGCCTTTGG + Intergenic
1108419942 13:50238408-50238430 TGGAGGTCTTTCTTGGACTTGGG + Intronic
1109268974 13:60233161-60233183 TCCAGGAATTTCAAGCCCTTTGG + Intergenic
1111858287 13:93668654-93668676 TCCAGGGGTTGCTTGGCCTGTGG - Intronic
1112117534 13:96373044-96373066 TCCAGGTCTTCCTTGGCTTGTGG + Intronic
1112581773 13:100682382-100682404 TACATGACCTTCTAGGCCTTGGG - Intergenic
1113371232 13:109727445-109727467 ACCAGGACTGTGTTTGCCTTCGG + Intergenic
1114277784 14:21163273-21163295 TCCAGGAATTTCCTCGTCTTCGG - Intergenic
1114530606 14:23393266-23393288 ATCAGGACTTTCTGGGCCATTGG + Intronic
1118554429 14:66999545-66999567 GCCAGTTATTTCTTGGCCTTTGG + Intronic
1121155239 14:91677102-91677124 TCCAGGATTTTTATGGCTTTGGG - Intronic
1122295219 14:100701721-100701743 TCCATGCCTTTGGTGGCCTTTGG + Intergenic
1123846881 15:24312137-24312159 TCAGGGAATTTCTAGGCCTTGGG + Intergenic
1126721809 15:51589290-51589312 TACAGGTCTTTCTTGTCTTTGGG - Intronic
1127715566 15:61645866-61645888 TCCAGGAGTTGCTTGGCTTGGGG - Intergenic
1128760165 15:70211195-70211217 TCCAGGTCTTTCTGTGGCTTGGG - Intergenic
1128877338 15:71213187-71213209 TCCAGGAATTCCTTGGCTTGTGG + Intronic
1132801258 16:1755164-1755186 TCCAGGTCTGTCTTGGCTCTTGG - Intronic
1133884207 16:9810612-9810634 TCCAGGTGTTTCTTGGCTTGTGG - Intronic
1134048961 16:11123586-11123608 TCCATGACTCTGTTGGACTTGGG + Intronic
1134232576 16:12440000-12440022 TCCTGGAATTGCGTGGCCTTGGG + Intronic
1135648494 16:24185295-24185317 TCTATGACTTTCCCGGCCTTGGG + Intronic
1137777803 16:51071117-51071139 TGCAGGAGTTCCTTGGCTTTTGG - Intergenic
1138107823 16:54299600-54299622 TCCAGCATTTTCTTGGTCTGTGG + Intergenic
1139438360 16:66949704-66949726 TCCGGGAGTGTTTTGGCCTTTGG + Intergenic
1140219015 16:73030193-73030215 TCCAGGCCACTCTTGCCCTTGGG - Intronic
1140756699 16:78074142-78074164 TCCAAGACTTTCTGGGAATTTGG + Intergenic
1140792230 16:78402958-78402980 TCTGGGACTTTCTGGGCCCTGGG - Intronic
1141289942 16:82708559-82708581 TCCTCTACTTTCTTGACCTTGGG + Intronic
1141303235 16:82837431-82837453 TCTAGGACTTCCTAGGACTTGGG - Intronic
1141320312 16:83002338-83002360 TCCAGGTGTTTCTTGGCTTGAGG - Intronic
1141515537 16:84542338-84542360 TCTAGGACATTCTAGGCTTTTGG - Intronic
1141803689 16:86328220-86328242 TCCAGGACTCTCTTGGACTCTGG + Intergenic
1143939644 17:10526779-10526801 GCCAGGGCGTTCTTGGCCTATGG + Exonic
1144210292 17:13008717-13008739 TCCAGGAGTCTCTTGGCATGAGG - Intronic
1144718049 17:17447929-17447951 TCCAGGTGTTTCTTGGCTTGTGG - Intergenic
1145255278 17:21318815-21318837 TCCAGCACTCTCTTGCCTTTCGG + Intergenic
1145321333 17:21769140-21769162 TCCAGCACTCTCTTGCCTTTCGG - Intergenic
1148771402 17:50069234-50069256 TTCATAACTTTGTTGGCCTTGGG - Intronic
1149362638 17:55911135-55911157 TCCAGGTCTTTGTTGGGCCTGGG + Intergenic
1151073045 17:71238826-71238848 TCCAGGACATTCATTGCCTGAGG - Intergenic
1151487591 17:74411045-74411067 TCCAGGTGTTTCTTGGCTTGTGG - Intergenic
1151518441 17:74612395-74612417 TCCAGGGAATTCTTGCCCTTGGG + Exonic
1152137104 17:78510974-78510996 TCCAGGCATTCCTTGGCCTGTGG - Intronic
1152387795 17:79985498-79985520 TCGAGGACCTGCCTGGCCTTGGG - Intronic
1153244756 18:3062946-3062968 TCCAAGAATTGCTTGGCCTGAGG + Intergenic
1156282037 18:35648825-35648847 TCCATAACTTTCTTGGGCTGGGG - Intronic
1157183414 18:45517720-45517742 TCCAGGACTTTCTGTCCTTTTGG + Intronic
1157624800 18:49042332-49042354 TCCACGAGTCCCTTGGCCTTAGG + Exonic
1158045235 18:53147629-53147651 GCCAGTACATTCTTGGCCTGTGG + Intronic
1158410387 18:57200103-57200125 CCCAGGACTTCCCAGGCCTTTGG + Intergenic
1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG + Intronic
1160068648 18:75604507-75604529 TCTAGGGCTTTTTTGGCTTTAGG - Intergenic
1161851923 19:6741733-6741755 TCCAGGGCTTTTTTGGATTTTGG - Intronic
1163252653 19:16135450-16135472 CCCAGGTCTTCCTTGGGCTTAGG + Intronic
1163329288 19:16626866-16626888 TCCAAGAGTTTCTTGGCAGTAGG - Intronic
1165911440 19:39230774-39230796 TCCAGGCCTTTCCTCGTCTTTGG + Intergenic
1165923341 19:39312225-39312247 TCCAGTGTTTTCTTGGCCATAGG - Intronic
1167408708 19:49332161-49332183 TCCAGGAGTTCCTTGGCTTGTGG + Intergenic
1168282260 19:55312021-55312043 GCCAGGAGCTTCTTGTCCTTGGG - Exonic
927694665 2:25231605-25231627 TCCAGGTCTGTCTTGGCCAGGGG - Exonic
930557620 2:52919117-52919139 TGCAGGATTTTCATGGCTTTAGG - Intergenic
930611866 2:53553641-53553663 TCCAGGTCCTTCCTGGCCGTGGG - Intronic
931024051 2:58088024-58088046 TCCATGACTTTCTTGCCATATGG - Intronic
931150230 2:59564946-59564968 TCCAGGCATTTCTTGGCCTGTGG + Intergenic
931538145 2:63300904-63300926 TCCAGGTCTCTCTCTGCCTTTGG + Intronic
932216692 2:69970695-69970717 TCCCGGTGTTTCTTGGCCTTTGG + Intergenic
932799165 2:74724157-74724179 TCCAGGGCCCTCTTGGCCCTGGG - Intergenic
934928214 2:98396944-98396966 TCCAGGGCCTTCTTGGCTTCGGG - Exonic
935419186 2:102849022-102849044 TCCAAGACTTTCCTGACATTTGG - Intergenic
935464877 2:103384466-103384488 TCCAGGCTTTTCTTAGCTTTTGG + Intergenic
936285882 2:111181057-111181079 TCCAGGAATTCCTTGGCTTGTGG + Intergenic
937429059 2:121823415-121823437 TCAAGGATTTTCTTGGCCCCTGG + Intergenic
937601261 2:123737399-123737421 TTCAGGATTCTCTTTGCCTTTGG + Intergenic
940882107 2:158957128-158957150 TCCAGGCATTTCTTGGCTTATGG - Intergenic
941087470 2:161134557-161134579 TTCAGGATTTTATTGGCCTGTGG - Intergenic
942002501 2:171662847-171662869 TCCAGGCATTTCTTGGCTTGTGG + Intergenic
946161559 2:217838950-217838972 CCCAGGACTTTCTCAGTCTTTGG + Intronic
946869045 2:224069471-224069493 TCCAAGAGTTCCTTGGCTTTCGG + Intergenic
948042834 2:234917394-234917416 ACCAGGATTTTAATGGCCTTAGG - Intergenic
1169475791 20:5930133-5930155 TCCAGGCCTTCCTTGGCTTGTGG + Intergenic
1169614067 20:7418959-7418981 TCCTTGTCTTTCATGGCCTTGGG + Intergenic
1171046946 20:21817743-21817765 TCCAGGACTTCCCTTGTCTTGGG - Intergenic
1171361311 20:24588273-24588295 TCCAGGTGTTCCTTGGCCTCTGG - Intronic
1171815966 20:29786450-29786472 TCCAGGACTTGCTGAGCCATAGG + Intergenic
1172399432 20:34636831-34636853 GCCAGCAATTTCTAGGCCTTTGG - Intronic
1173004477 20:39129176-39129198 TCCAGGGCTTCCTAGGCCCTTGG - Intergenic
1173235328 20:41239905-41239927 TCCAAGACATTCTTCTCCTTGGG - Intronic
1173816257 20:45990819-45990841 TCCAGGAGTTCCTTGGCTTGTGG + Intergenic
1174520723 20:51128542-51128564 CCCAGGACTTTCTGTGGCTTCGG - Intergenic
1174850502 20:53989420-53989442 ACCAAGACTTTCTTGGTCTTAGG - Intronic
1178602962 21:34010888-34010910 TCTCAGACTTTCTTGGTCTTTGG + Intergenic
1179640855 21:42746422-42746444 TCCCGGTCTCTCTTGGCCTCTGG + Intronic
1181105867 22:20574915-20574937 TCCAGGTCTGTCTGGGCATTGGG - Intronic
1181879100 22:25963410-25963432 TCCAGGCATTCCTTGGCCTGTGG + Intronic
1182751189 22:32643476-32643498 TCAAGGACTCTCTGGGCTTTTGG - Intronic
1183181397 22:36262502-36262524 TCCCGGTCTCTCTGGGCCTTTGG - Intronic
1183213807 22:36466621-36466643 TGCAGGAACTTCTGGGCCTTGGG - Intergenic
1184594434 22:45505238-45505260 TCCAAGGCTTTCTTGGCCTCTGG + Intronic
1185092206 22:48782001-48782023 TGCAGGCCTTTCTTGGCATGTGG - Intronic
950573279 3:13815281-13815303 CCCAGGACTGTCCTGACCTTGGG + Intergenic
950573298 3:13815353-13815375 CCCAGGACTGTCTTGACCTTTGG + Intergenic
950612317 3:14134341-14134363 CCCAGGACTATCTGGGCCCTTGG - Intronic
951112907 3:18825743-18825765 TCCAGAACTCTCTTTTCCTTTGG + Intergenic
951694492 3:25431555-25431577 TCCAGGATTATCTTGGTTTTAGG + Intronic
953191010 3:40688187-40688209 TCCAGGACTATCCTGGCTTTAGG + Intergenic
953390487 3:42531068-42531090 TTGAGGACTTTCTTGACCCTTGG - Intronic
954144678 3:48628698-48628720 CCCCGGACTTCCTTGGCCTGGGG + Exonic
954217938 3:49134705-49134727 TCCAGGAATCTCCTGGCCTTGGG - Intergenic
955815198 3:62834827-62834849 TAAAGGACTTACTTGGCTTTTGG + Intronic
955982450 3:64540590-64540612 CCCATGAATTTCTTGGCTTTGGG + Intronic
956144854 3:66182364-66182386 TCCAGAACCTTTTTGACCTTTGG + Intronic
956587329 3:70878518-70878540 TCCAAGAATTTATTGGCCTTGGG + Intergenic
956973572 3:74554377-74554399 TCCAGGATTGTCTTGGCTATGGG + Intergenic
959569430 3:107867249-107867271 TCCAGGAGTTTCTGACCCTTAGG + Intergenic
960849137 3:122034354-122034376 TCCAGGATTTTCTTGTCATATGG - Intergenic
961852053 3:129830251-129830273 TCAATGACTGTCTTGGCCTCTGG + Intronic
962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG + Intronic
964260934 3:154835860-154835882 CCCTGGACTTGCATGGCCTTAGG + Intergenic
964948511 3:162257121-162257143 TCCAGGACTTTTATGGTTTTAGG + Intergenic
968970115 4:3789359-3789381 TCCAGGCGTTTCTTGGCTTTTGG - Intergenic
969286524 4:6205790-6205812 TCCAGGACTTCCTTGGCTTGCGG + Intergenic
969723268 4:8905030-8905052 TCCAAGGCTTTCCTGGCCCTCGG + Intergenic
970565478 4:17328058-17328080 TCCAGGACTTTCTGATCCTAAGG - Intergenic
970772300 4:19628516-19628538 TCCCAGAATTCCTTGGCCTTTGG + Intergenic
971421058 4:26474574-26474596 TCCAGGGATTTCTTTTCCTTAGG + Intergenic
972262091 4:37419279-37419301 TCCAGGACTTTTATGGTCCTAGG - Intronic
975032695 4:69641506-69641528 TCCAGGCTTTTTTTGGCCTTGGG - Intronic
975928263 4:79486501-79486523 TCCAGGCATTTCTTGGCTTGTGG - Intergenic
977138925 4:93341715-93341737 TCCAGGACTTTCCCAGCCTGTGG - Intronic
977426002 4:96867888-96867910 TCCAGGGCTTTTATGGCCTTAGG - Intergenic
977650232 4:99460865-99460887 TCCAGGGCTTTCTTGCCCCTTGG + Intergenic
980340121 4:131533541-131533563 TCCAGGTCTATCTTGTCCCTAGG + Intergenic
980753881 4:137130571-137130593 TGCAGGACTCACTTGGCCTAGGG + Intergenic
982409056 4:155052941-155052963 TCCAGGCATTCCTTGGCTTTTGG + Intergenic
983290189 4:165792890-165792912 TCCAGGACTTTCATAGCTATAGG - Intergenic
983927226 4:173415249-173415271 TTCAGGATTTTATTGCCCTTAGG + Intergenic
985976339 5:3421149-3421171 TGCACGACTTTCTGGGCCTCAGG - Intergenic
987117238 5:14735642-14735664 TCCAGGCCTTTCCTGGCTTCTGG + Intronic
987291131 5:16509400-16509422 CCCAGGACTTCCCTGTCCTTAGG + Intronic
990569417 5:57063037-57063059 TCCTGGAGGTTCTTGGCCTCTGG + Intergenic
990809080 5:59701984-59702006 ACCAGTGCTTTCTTGGCCCTTGG - Intronic
992100097 5:73398632-73398654 TCCAAGTCTTTCTTGGAGTTGGG - Intergenic
994086961 5:95769365-95769387 TCGAAGACTTTCTTGACCATAGG - Intronic
994199686 5:96958696-96958718 TCCTGCACTTTTTTGGCTTTTGG + Intronic
994541124 5:101098940-101098962 ATCAGGACTTTCTTTTCCTTTGG - Intergenic
995726182 5:115182444-115182466 TCCACCACTTTCTTGGTCTTGGG - Intergenic
995888432 5:116922058-116922080 TCCAGGCCTTTCTTGGCTTGTGG - Intergenic
998188095 5:139998370-139998392 TCCAGGACTTTCTTGGCCTTGGG - Intronic
998233195 5:140374792-140374814 GTCAGGACATTTTTGGCCTTTGG + Exonic
999176654 5:149636519-149636541 TCCAAGACCTACTTGGCCATAGG + Intergenic
1002716692 5:181232529-181232551 TCCGGGACTATCTTGGACCTGGG + Intronic
1004359401 6:14957628-14957650 CCCAGCACTTTCTAGGCCATAGG + Intergenic
1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG + Intergenic
1006645091 6:35510259-35510281 TCCAGAGCTTTTTTGGCCTCAGG - Intronic
1006974020 6:38079893-38079915 CCCAGGACTTTCTGGGTGTTGGG + Intronic
1007694014 6:43720154-43720176 CCCAGAACTTCCCTGGCCTTTGG - Intergenic
1007720928 6:43885064-43885086 TCCATGTCTTTGTTGGCCATTGG + Intergenic
1007742861 6:44023351-44023373 TCCAGATCTATCTTGGCCGTGGG - Intergenic
1008174165 6:48246186-48246208 ACCAGGAGTTGCTTGGCCTGGGG - Intergenic
1011544734 6:88470691-88470713 TCAAGGCATTTCTTGGCTTTCGG - Intergenic
1012302500 6:97606661-97606683 TCCAGGAATTCCTTGGCTTCCGG + Intergenic
1013562069 6:111315625-111315647 TCCAGGACTTTCTTGACTACTGG - Intronic
1015949945 6:138542208-138542230 TCCAGGCATTTCTTGGCTTTCGG - Intronic
1017225701 6:152018715-152018737 TCCAGGACTGTTTAGGCCCTGGG + Intronic
1017907572 6:158767496-158767518 TCCTGGGCTTCTTTGGCCTTTGG + Exonic
1020369847 7:7419908-7419930 TCCAGGTCCTTCTGGGCCTCGGG - Exonic
1021414629 7:20368120-20368142 TCCATTACTTTCTTGGCCCTGGG + Intronic
1022496568 7:30856602-30856624 TGCAGTACTTTCTTGGTCTGTGG - Intronic
1026347417 7:69486124-69486146 TCCTGGACTTTTTAGGCTTTTGG - Intergenic
1029536661 7:101161270-101161292 TTCTGGACTTTGCTGGCCTTGGG + Exonic
1031158792 7:118141913-118141935 TTTAGGACTTTCTTCTCCTTAGG + Intergenic
1032472810 7:132190614-132190636 CCCAGGACTTTCTTTTCTTTGGG - Intronic
1032795081 7:135270280-135270302 TCCAGGAGCCTCTTCGCCTTTGG - Intergenic
1034023824 7:147675147-147675169 TCCAGGCTTTTATTGGCTTTTGG + Intronic
1036684381 8:10899498-10899520 TCCTGGATCTTGTTGGCCTTGGG - Intronic
1036710719 8:11076822-11076844 GCCTGAACTTTCTTGTCCTTGGG - Intronic
1036774862 8:11604159-11604181 TCCAGGTGTTTCTTGGCTTGTGG + Intergenic
1037208753 8:16359075-16359097 TCCTGGGCTTTCTTTGCCTGAGG + Intronic
1038462850 8:27730989-27731011 TCCAGGACCTCCTGGGCTTTGGG + Intergenic
1039099338 8:33924090-33924112 TCCAGGTGTTTCTTGGCTTGTGG + Intergenic
1040365320 8:46709340-46709362 GCCTGGACTTTCTTTGCCATTGG - Intergenic
1041162547 8:55060098-55060120 CCCAGGATTTTATTGGGCTTTGG - Intergenic
1041903809 8:63009880-63009902 TCCTGGACTCTCTTGGCTTGTGG + Intergenic
1043840413 8:85096074-85096096 TCCAGCCCCTTCTTGGCCTCTGG - Intergenic
1043883812 8:85575265-85575287 GCCAGGACTTTCTAGGCCCTGGG + Intergenic
1045729941 8:105226180-105226202 ACCTTCACTTTCTTGGCCTTAGG + Intronic
1046568789 8:115935884-115935906 TCCAGGAATTTCTATGCCATAGG + Intergenic
1048033136 8:130651787-130651809 TCCAGGCATTTCTTGGCTTGGGG + Intergenic
1049201460 8:141342605-141342627 TCCAGGCCTGTCTTCCCCTTGGG + Intergenic
1049646372 8:143737635-143737657 TCCAGGCCTTACCTGGCCTTGGG + Intergenic
1051218553 9:14824920-14824942 TCCTGGAGTTTCTCGGCATTTGG - Exonic
1052215802 9:25964436-25964458 TCCAGGTCTCTCTCTGCCTTTGG - Intergenic
1056723371 9:89090206-89090228 TCCTGGACTCTCTTTGCCTCTGG - Intronic
1056729793 9:89155719-89155741 ACAAGGACTTTCCTTGCCTTGGG + Intronic
1057083064 9:92187277-92187299 TCAAGGACTTTCCTGGCACTAGG - Intergenic
1058694261 9:107546152-107546174 TCCAAGACTTGCTTGCCCCTTGG + Intergenic
1059745330 9:117194706-117194728 TCCAGCACATGCTTGGACTTGGG + Intronic
1060193776 9:121609774-121609796 TCCAGGGCTATCTTGGTCCTTGG + Intronic
1061697809 9:132390701-132390723 TTCAGGATTTTCTTGGAGTTTGG + Exonic
1186726211 X:12361852-12361874 TCCAGGCATTTCTTGGCTTATGG + Intronic
1189161376 X:38812733-38812755 TTCAGGACATTCCTGGCCATTGG + Intergenic
1190066518 X:47245188-47245210 TCCAGGTCAAGCTTGGCCTTGGG + Intronic
1191051841 X:56201984-56202006 TTCAGGACTCTCTTGGGATTCGG + Intergenic
1191870643 X:65742221-65742243 TCCTGGACTTGCCTGGCATTGGG + Intergenic
1192555210 X:72083856-72083878 TGCAGGGCCTTCTAGGCCTTAGG - Intergenic
1193581220 X:83265431-83265453 TCCAGGATTTTCATAGTCTTTGG - Intergenic
1193975666 X:88115295-88115317 TCCAGGGCTTCTTGGGCCTTTGG + Intergenic
1196246055 X:113401835-113401857 TCCATGACTTTATTCACCTTTGG - Intergenic
1196558235 X:117117002-117117024 TCCAGGGCTTCTTGGGCCTTTGG - Intergenic
1196697026 X:118624351-118624373 CACAGAACTTTGTTGGCCTTTGG - Intronic
1197318003 X:124992220-124992242 TCCAGGACAGTCTTGGCAGTGGG - Intergenic
1197674580 X:129315547-129315569 TGCAGGGATTTCTGGGCCTTGGG - Intergenic
1199853878 X:151744193-151744215 TCTAGGACTTTCTTGGCATCAGG - Exonic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic