ID: 998188197

View in Genome Browser
Species Human (GRCh38)
Location 5:139999228-139999250
Sequence CGGCATAAGGGGAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998188197 Original CRISPR CGGCATAAGGGGAATGAGGC AGG (reversed) Intronic
900543889 1:3217917-3217939 CGGCAAGAGGGGGAAGAGGCCGG - Intronic
903642429 1:24869025-24869047 GGGCATAGGGAGACTGAGGCAGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904676435 1:32201697-32201719 AGGCAGAAGGGGAATTAGGTTGG + Intronic
905284930 1:36873123-36873145 CAGGATGAGGGGAATGAGGTGGG - Intronic
906569328 1:46822754-46822776 AAGCATAATGGGAATGAGACAGG - Intergenic
910538157 1:88323581-88323603 CGGCCGAAGGGGAAGGAGACAGG + Intergenic
912481476 1:109984994-109985016 CGCCAGAGGGGGAAAGAGGCGGG + Exonic
912703266 1:111894246-111894268 CCTCATAATGGGAATGAGCCTGG - Intronic
915320056 1:155051528-155051550 AGGCATTAGGGTAATGGGGCCGG + Intronic
918081333 1:181209932-181209954 CGGAATTAGAGGAATGAGCCTGG - Intergenic
920106535 1:203557214-203557236 AGGGATAAGGGAAATCAGGCAGG + Intergenic
921325929 1:213986267-213986289 CGGCAAAAGGGGAAAGAAGAAGG + Intronic
923098172 1:230792228-230792250 CGGCAGAAGTGGAATGGGGGTGG - Intronic
1063475571 10:6325895-6325917 CGGCAGAAGGAGCATGAGGAAGG - Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064481229 10:15742828-15742850 AGGCATAAAAGAAATGAGGCAGG - Intergenic
1067352579 10:45489980-45490002 GGGCATGAGAGGAAGGAGGCTGG - Intronic
1071556050 10:86602298-86602320 GGGCAGGAGGGGAGTGAGGCTGG - Intergenic
1072611362 10:97019460-97019482 GGGCATGAGGGGAAAGAGGAAGG - Intronic
1073110706 10:101061634-101061656 CTGCATAAGGGGGAGGCGGCAGG - Intergenic
1073112984 10:101073754-101073776 TGGCATTTGGGGGATGAGGCGGG - Intergenic
1074716247 10:116222104-116222126 CGGTAGAAGGGGAAAGAGCCAGG + Intronic
1075083781 10:119400744-119400766 AGGAATAAGGGGGATGAGGAAGG + Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076519680 10:131073766-131073788 CCGCCTAGGGGGAGTGAGGCTGG - Intergenic
1076673086 10:132133787-132133809 CAGCAGAAGGGTGATGAGGCCGG - Intronic
1077931209 11:6734905-6734927 TGGCAGAAGGGGAAACAGGCAGG - Intergenic
1082636449 11:55599982-55600004 CAGCATCAGGGGAGTGAAGCTGG + Intergenic
1084126264 11:67101046-67101068 CAGCACAAAGGGACTGAGGCAGG - Intergenic
1084453610 11:69254588-69254610 CAGCCAAAGGGGAATGAGGAGGG + Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1094487279 12:30935098-30935120 TGGCACAAGGGGAATTTGGCTGG - Intronic
1097169892 12:57106698-57106720 CTGCAGAAGGGGGCTGAGGCTGG - Exonic
1097237395 12:57549759-57549781 AGGGATAAGGGGACTGAGGTGGG - Intergenic
1098085431 12:66837520-66837542 CAGCAAAAGTGAAATGAGGCTGG + Intergenic
1098119716 12:67223069-67223091 AGGAATGAGGGGAAAGAGGCGGG + Intergenic
1099263940 12:80419851-80419873 CTGCATGAGAGGAATGAGACTGG - Intronic
1100585843 12:95978454-95978476 TGGCATTTGGGGACTGAGGCTGG + Intronic
1101120078 12:101570303-101570325 TGGGATAAGGGGAATGAGAGAGG - Intronic
1102397054 12:112595501-112595523 AGGCAAAAGGGGAAGGAGGAGGG - Intronic
1102492332 12:113296814-113296836 CGGAGGAAGGGGCATGAGGCAGG + Exonic
1106297961 13:28435407-28435429 TGGCATCAGGGGAATTTGGCTGG - Intronic
1106926769 13:34621657-34621679 TGGCTTAAGGAGAATGAGGCAGG - Intergenic
1111985887 13:95066741-95066763 CGGCAGAATGGGCAAGAGGCAGG - Intronic
1114645830 14:24255579-24255601 TGGGATCAGGGGAAGGAGGCCGG - Intronic
1115875095 14:37852503-37852525 CGGCATAAGGAGAAAAAGGACGG + Intronic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1120620361 14:86755759-86755781 CAGCATAAGGGGTAGAAGGCAGG + Intergenic
1124856129 15:33391117-33391139 AGGGATGAGGGGAAAGAGGCAGG - Intronic
1124897291 15:33788935-33788957 CGGGGTAAGGGGAATTAGGAGGG + Intronic
1124917756 15:33993473-33993495 TGGCACAAGTGGAAGGAGGCAGG + Intronic
1125343531 15:38697063-38697085 TGGTATAAGGGGCATGGGGCAGG - Intronic
1129198913 15:73986995-73987017 AGGCAGAAGGGCAAGGAGGCAGG + Intronic
1135688105 16:24514592-24514614 AGGCATCAGAGCAATGAGGCAGG - Intergenic
1136515256 16:30764446-30764468 GGGCATTAGGGGAATCAGGAAGG - Intronic
1138447645 16:57074596-57074618 CAGCAGAAGGTGACTGAGGCTGG - Exonic
1140650483 16:77082770-77082792 CGGCATAAATTGAATAAGGCAGG - Intergenic
1143119509 17:4598216-4598238 AGGCAGGAGGGGAATGAGGTTGG - Intronic
1143399918 17:6637400-6637422 AGGCATATGGGGAAGGAGACTGG - Intronic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1145242044 17:21245796-21245818 AGGCATGAGGGGAGTGGGGCTGG - Intronic
1146538396 17:33673255-33673277 AGGCATAAAGGGGATGAGGAGGG + Intronic
1147723020 17:42550258-42550280 GGGCACTAGGGGAAGGAGGCAGG + Exonic
1148052372 17:44775551-44775573 CGGGAGGAGGGGAAGGAGGCGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148756761 17:49977148-49977170 AGGCAGACGAGGAATGAGGCTGG + Intergenic
1151926747 17:77203289-77203311 CGGGATGAGGGGAATCCGGCTGG - Intronic
1155573853 18:27224052-27224074 GGGCACAGTGGGAATGAGGCTGG - Intergenic
1158146962 18:54325155-54325177 CAGGATAAGGGAAATGAGGGAGG - Intronic
1158441678 18:57480114-57480136 CCACATAGGGGGAATGAGGAGGG - Exonic
1158734484 18:60063926-60063948 TGGCATAAGGAGCCTGAGGCAGG - Intergenic
1160822075 19:1063427-1063449 GGGCATAATGGGCATGGGGCAGG - Intronic
1162904709 19:13816875-13816897 GGGAATAAGGGCAATGAGGAGGG + Intronic
1163012501 19:14434316-14434338 TGGCACAAGGGGAATCTGGCTGG - Intronic
1163385512 19:16997552-16997574 GGGCAGAAGAGGAAAGAGGCTGG + Intronic
1163741129 19:19013573-19013595 AGGCACAAGGGGAAGGAGGGAGG - Intronic
1164162216 19:22634608-22634630 TGGCTGAAGGGGACTGAGGCTGG - Intronic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165357637 19:35313552-35313574 GGGCAGGAGGGGAGTGAGGCAGG + Exonic
1168286468 19:55337177-55337199 CGGCAGAAGGGAACTGGGGCTGG - Intergenic
925441936 2:3895486-3895508 GGGCACAATGGGAATGAGACTGG - Intergenic
928135992 2:28687874-28687896 CTCCATAAGGGGTGTGAGGCTGG - Intergenic
929096523 2:38267703-38267725 GGGAGTAAGGGGAATGAGTCAGG - Intergenic
929405201 2:41633869-41633891 AGGCAAAAGGGGAATGGAGCAGG - Intergenic
929489519 2:42384031-42384053 GGGAAGAAGGGGATTGAGGCTGG - Intronic
931082340 2:58788517-58788539 CAGCATAAGGGGAAGGATACAGG + Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
934138478 2:89020610-89020632 GGGCAGAAGGGAAATGAGGGAGG - Intergenic
934151893 2:89154931-89154953 CAGAATAACGGGAATGAGCCTGG - Intergenic
934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG + Intergenic
934230766 2:90179943-90179965 GGGCAGAAGGGAAATGAGGGAGG + Intergenic
934901622 2:98164189-98164211 CGGCAGAAGGGGACACAGGCTGG + Intronic
935132418 2:100270596-100270618 CTCCACAAGGGGAATGCGGCAGG - Intergenic
937380427 2:121371694-121371716 CGGCTTTAGGGGCTTGAGGCAGG - Intronic
946534858 2:220615924-220615946 CTGTATGAGGGGAATGAGACTGG - Intergenic
947639222 2:231696947-231696969 CTGCATGAGGGGAATGAGGTGGG + Intergenic
947814576 2:233027701-233027723 CGGAATAATCGGAATGAGTCAGG + Intergenic
1170669698 20:18420431-18420453 TGGCTTAAGGCGAATGAGCCAGG + Intronic
1171312009 20:24152097-24152119 GAGCACAATGGGAATGAGGCTGG + Intergenic
1171557988 20:26095699-26095721 CGGCATAATGGGAAGGAAGTAGG - Intergenic
1172175743 20:32970902-32970924 AGGCATAACGGGCATGAGACAGG - Intergenic
1173575694 20:44111896-44111918 GAGCATGAGGGGAATGGGGCGGG - Exonic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174340718 20:49893367-49893389 GGGCACTAGGGGAATGAAGCTGG + Intergenic
1181581201 22:23829061-23829083 GGGCTCAAGGGGAAGGAGGCTGG + Intronic
1183273392 22:36875949-36875971 GGGGGAAAGGGGAATGAGGCTGG - Exonic
1183330143 22:37215117-37215139 AGGCATAAGGGGCATAAAGCGGG - Intergenic
1184302256 22:43568580-43568602 CGGGTTCAGGGGAATGAGGCGGG + Intronic
1185074388 22:48675503-48675525 CAGCAAAAGGGGAAATAGGCTGG + Intronic
1185383029 22:50518833-50518855 CCACAGAAGGGGCATGAGGCTGG - Intronic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
953837805 3:46362286-46362308 AGGCATGGGAGGAATGAGGCTGG + Intergenic
954706177 3:52481781-52481803 GGGCACAAGGGGAGTGAGGAGGG - Intronic
954762616 3:52887648-52887670 AGGCATAAGGGCATGGAGGCAGG - Intronic
955163495 3:56488054-56488076 AGGCAGGAGGGGATTGAGGCAGG - Intergenic
955461651 3:59189837-59189859 CGGCACTATGGGAATGAGACTGG - Intergenic
955725502 3:61928094-61928116 TGCTATAAGGGGTATGAGGCCGG + Intronic
956701952 3:71966490-71966512 AGGCAAGAGGAGAATGAGGCTGG + Intergenic
961059230 3:123814243-123814265 CGGAATAGGGTGAATGTGGCCGG - Intronic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
963255876 3:143144572-143144594 CAGCATAAGAGGTATGGGGCAGG + Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
969901519 4:10354774-10354796 GGGCATAGTGGGAATGAGACTGG - Intergenic
971298789 4:25424919-25424941 GGCCATTTGGGGAATGAGGCAGG + Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
986293485 5:6418533-6418555 AGGTATGAGGGGCATGAGGCTGG - Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993480494 5:88418318-88418340 TGGCATGTGGGGACTGAGGCAGG + Intergenic
998188197 5:139999228-139999250 CGGCATAAGGGGAATGAGGCAGG - Intronic
999922422 5:156336082-156336104 AGGCAGAAGGGGAAAGAAGCAGG - Intronic
999973871 5:156891752-156891774 CATCATAGGGAGAATGAGGCTGG - Intergenic
1004058049 6:12161173-12161195 TCTCAGAAGGGGAATGAGGCAGG - Intronic
1005072470 6:21874493-21874515 GGGCATGATGGGAGTGAGGCTGG + Intergenic
1006309477 6:33247867-33247889 CGGCATAAGGCGAGGGCGGCAGG - Intergenic
1006716710 6:36125014-36125036 GGGCACAGGAGGAATGAGGCTGG + Intergenic
1015626196 6:135182450-135182472 CGGCTCAAGGGGACAGAGGCCGG + Intronic
1034991232 7:155549200-155549222 CGGCAGAAGTGGAAAGGGGCCGG + Intergenic
1035709700 8:1703071-1703093 TGGGATGTGGGGAATGAGGCAGG - Exonic
1035935452 8:3832251-3832273 AGGAATAAGGGAAATCAGGCAGG - Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048828093 8:138449300-138449322 TGCCATAAAGGGATTGAGGCTGG + Intronic
1049369128 8:142255112-142255134 CGGCTGAAGGGGAGTGAGGCAGG + Intronic
1049758725 8:144322303-144322325 CGGCAGATGGGGGGTGAGGCGGG - Intronic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052779687 9:32768269-32768291 TGGCATAAGGGGAACAAGGAGGG - Intergenic
1055599560 9:77901519-77901541 CGGCCTAAGGAGGAAGAGGCAGG - Intronic
1060010671 9:120040612-120040634 AGGCATAAGGAAAGTGAGGCTGG - Intergenic
1060393622 9:123300360-123300382 AGGGATTAGGGGCATGAGGCTGG - Intergenic
1060776217 9:126376746-126376768 CGGCAGGTGGGGAAGGAGGCTGG - Intronic
1062214990 9:135384324-135384346 CCGCATAAAAGGACTGAGGCAGG - Intergenic
1186342321 X:8657833-8657855 AGGAAGAAGGGGAGTGAGGCAGG + Intronic
1188530308 X:31133131-31133153 CTCCATAAGGGCAATGAGGAGGG - Intronic
1190936821 X:55005223-55005245 ATGCATAAGAGGAATGAGGCAGG - Intronic
1192981952 X:76353686-76353708 GGGCATGATGGGAATGAGACTGG + Intergenic
1193566024 X:83078181-83078203 CAGCATAATTGGAATGAGTCAGG - Intergenic