ID: 998188325

View in Genome Browser
Species Human (GRCh38)
Location 5:140000365-140000387
Sequence CTGCGGCAGGGGAAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 508}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998188325_998188334 -6 Left 998188325 5:140000365-140000387 CCTTCCAGCTTCCCCTGCCGCAG 0: 1
1: 0
2: 2
3: 50
4: 508
Right 998188334 5:140000382-140000404 CCGCAGAGGCATGGAGGACCAGG No data
998188325_998188336 18 Left 998188325 5:140000365-140000387 CCTTCCAGCTTCCCCTGCCGCAG 0: 1
1: 0
2: 2
3: 50
4: 508
Right 998188336 5:140000406-140000428 TTAGCACTCTAGCCACTCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 81
998188325_998188337 25 Left 998188325 5:140000365-140000387 CCTTCCAGCTTCCCCTGCCGCAG 0: 1
1: 0
2: 2
3: 50
4: 508
Right 998188337 5:140000413-140000435 TCTAGCCACTCCAAGGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998188325 Original CRISPR CTGCGGCAGGGGAAGCTGGA AGG (reversed) Intronic
900329205 1:2125763-2125785 CTGCGGCATGGACTGCTGGAGGG - Intronic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
901666778 1:10830634-10830656 CTGGGGCAGGGGGCGCTGGGGGG + Intergenic
901757697 1:11451272-11451294 CTGGGGCTGGGGAAGCGGGAGGG + Intergenic
901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG + Intronic
902048225 1:13541935-13541957 ATGCGGCAGGGGAAGCCTGGGGG - Intergenic
902142337 1:14367250-14367272 CAGCGGGAAAGGAAGCTGGAAGG + Intergenic
902692468 1:18118386-18118408 CAGAGGCTGGGGCAGCTGGAGGG + Intronic
902826067 1:18975152-18975174 CTGCGGAAGGTGAAGCTACAGGG - Intergenic
902939135 1:19787179-19787201 CTACGGCAGAGGGAGCTGGCTGG + Intronic
903184851 1:21623081-21623103 GTGAGGCATGGGAAGCAGGATGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904190358 1:28737997-28738019 ATGGGGGAGGGGAAGCGGGAGGG + Intronic
904419267 1:30381139-30381161 CTGGGGGCGGGGAAGCTGGCGGG - Intergenic
904609364 1:31716589-31716611 CTGAGGGAGGTGGAGCTGGATGG - Intergenic
904857479 1:33510046-33510068 CTGAGGCAGGGGAATCAGGCAGG + Intergenic
905028651 1:34867192-34867214 CTGCAACAGAGGAAGATGGAGGG + Intronic
905348709 1:37329578-37329600 CTGCTGCAGGGCACCCTGGAGGG + Intergenic
905786542 1:40762495-40762517 CTGGGGCAGGTGAATTTGGAGGG - Intronic
907052800 1:51341070-51341092 CTGAGGCAGGAGAACCTGGAAGG + Intronic
907159476 1:52360080-52360102 CCAAGGCAGGGGGAGCTGGAGGG + Exonic
907909005 1:58810829-58810851 CTGGGGCAGGGGAAGAGGAAGGG - Intergenic
908771975 1:67605780-67605802 CTGAGGCAGAGGAAACTGGAGGG + Intergenic
910457539 1:87413535-87413557 CTGCGGCTGGGCATGGTGGAAGG - Intergenic
910629378 1:89340269-89340291 CTGCATCGGGGGAAACTGGAAGG + Intergenic
910771470 1:90836099-90836121 CTGCGGCCGCGGACCCTGGATGG - Intergenic
911242767 1:95483469-95483491 CTGGAGCTGGGGATGCTGGATGG + Intergenic
911884309 1:103278327-103278349 CTGAGGCAGGGGAATCCGGGAGG - Intergenic
912714735 1:111975007-111975029 CTGCAGCAGAGGAAGCCAGAGGG - Intronic
913486243 1:119334576-119334598 CTGCGGCAGGTGAGGCGAGAGGG - Intergenic
913975082 1:143449632-143449654 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
914069474 1:144275248-144275270 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
914109681 1:144691106-144691128 CTGACGCAGGGGAAGCCGGCCGG - Intergenic
915145058 1:153791963-153791985 CAGCAGCAGGGGAAGCTGGCCGG + Intergenic
915208239 1:154287016-154287038 CTGAGGCAGGAGAATCAGGAAGG - Intergenic
915562283 1:156694242-156694264 GGGTGGGAGGGGAAGCTGGAGGG + Intergenic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
919967146 1:202539214-202539236 CTGAGGCAGGGGACACTGGAAGG + Intronic
919981749 1:202646218-202646240 CAGTGCCAGGTGAAGCTGGAAGG - Intronic
920162720 1:204011654-204011676 CTGAGGCAGGGGGAGCAGGAGGG + Intergenic
921023849 1:211259766-211259788 CTGGGGGAGGGGAAGAGGGAGGG - Intronic
921180160 1:212625713-212625735 CAGCAGCAGGGGCAGCTGCAGGG + Exonic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
922462339 1:225823472-225823494 CTGAGTCTGGGGAAGCTTGATGG - Intronic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
922819766 1:228476264-228476286 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
923051244 1:230392780-230392802 CTCCGGCCTGGGAAGCTGGAGGG + Intronic
923712141 1:236395910-236395932 CTGCGGCATGGGCAGGGGGAAGG - Intronic
924857323 1:247886783-247886805 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1062858251 10:790280-790302 CAGCTGCAGGGAAAGCTGTAGGG + Intergenic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1064772206 10:18735080-18735102 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1065877198 10:30007745-30007767 CTGGGGCAGGGGCAGCTGGTGGG - Intergenic
1066265759 10:33774385-33774407 CTGCAGATGGGGAAGCCGGAAGG - Intergenic
1066360248 10:34723243-34723265 CTGCGGCAGGAGAACCTAGGAGG + Intronic
1066407551 10:35133395-35133417 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1069370924 10:67746940-67746962 CTGGTGCTGGGGAAACTGGATGG + Intergenic
1069583171 10:69578744-69578766 CTGGGACAGGGGCCGCTGGACGG + Intergenic
1069711465 10:70491745-70491767 CTGGGGGAGGGGAAACTGGGAGG - Intronic
1069732826 10:70630522-70630544 CTGCGGCAGGAGAATCAGGCAGG - Intergenic
1070675088 10:78406736-78406758 GTGAGGCCGGGGAAACTGGATGG + Intergenic
1071093241 10:81944966-81944988 CAGGGGCAGTGGAATCTGGATGG - Intronic
1071497934 10:86181288-86181310 CAGCTTCAGGGGCAGCTGGATGG - Intronic
1074153064 10:110775696-110775718 CTCCTGCAGAGGAAACTGGAGGG + Intronic
1074819644 10:117168507-117168529 CTGCTGCTGGGGAACGTGGAGGG - Intergenic
1075874832 10:125797627-125797649 CCACGGCAGGTGGAGCTGGAGGG + Intronic
1076357995 10:129866820-129866842 CTGCCGCAGTGGTAGCTGGGTGG + Intronic
1076607978 10:131701695-131701717 CTGCAGCAGTGTGAGCTGGAGGG + Intergenic
1076692435 10:132230660-132230682 CTGCTGGGGGGGAAGCTGGCGGG + Intronic
1077513594 11:2986714-2986736 CTGAGGCAGGAGAAACTGGGAGG - Intronic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1079130012 11:17741791-17741813 CTGAGGCAGGGGAACCTGGCAGG - Intronic
1080605558 11:33862135-33862157 AGGCAGCAGGGGAGGCTGGAGGG + Intronic
1081710565 11:45212974-45212996 CTGATGCTGGGGAAGCTGGTGGG - Intronic
1081928643 11:46852115-46852137 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1081937642 11:46916625-46916647 CTAGGGAAGGGGGAGCTGGAAGG - Intronic
1081988449 11:47324527-47324549 CTGCTGCAGGTGACCCTGGAAGG + Exonic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083674568 11:64318289-64318311 CTGCGGCAGCGGCAGCAAGACGG + Exonic
1083845250 11:65328099-65328121 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1083888806 11:65585606-65585628 CTGCGGCGGGGGAAGAAAGAAGG - Intronic
1084109155 11:67002367-67002389 CTGCGGGTGGGGCAGCTGCAGGG - Intergenic
1084274293 11:68043806-68043828 ACGTGGCAGTGGAAGCTGGAGGG - Exonic
1084423720 11:69073041-69073063 CAAGGGCAGGGGAAACTGGAAGG - Intronic
1084594233 11:70107518-70107540 CTGGGCCAGGGGGAACTGGAAGG + Intronic
1084768130 11:71325566-71325588 CCCCGGCACCGGAAGCTGGAAGG + Intergenic
1085073579 11:73571342-73571364 CTGAGGCAGGGGAATCAGGCAGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085532952 11:77202537-77202559 CTGGGTCAGAGGGAGCTGGAGGG + Intronic
1086243132 11:84720408-84720430 CTGCGGCAGTGGCAGCTCGCTGG + Intronic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1088999789 11:115042235-115042257 CTGCTGCAGGGGCAGCTGGCTGG + Intergenic
1089060169 11:115619908-115619930 CTGCGGCAGTGGAGGCTTAAGGG + Intergenic
1089540014 11:119184128-119184150 CAGAGGCAGTGGAGGCTGGAAGG + Intergenic
1089661748 11:119990649-119990671 CTGGGGCTGGGGAAGCTGCTGGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090278114 11:125433648-125433670 CTGCGGTCGGGGAAGCTGTCAGG - Intergenic
1090310480 11:125732350-125732372 AGGCGGCACTGGAAGCTGGAAGG - Intergenic
1090681590 11:129064980-129065002 CTCTGGCAGGGAAAACTGGATGG + Intronic
1090705145 11:129329530-129329552 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1090789004 11:130073740-130073762 CTGAGGCAGGAGAATCTGGGAGG + Intronic
1092039398 12:5370703-5370725 CTGCTGGAGGGGAAGCTTGGGGG - Intergenic
1092131261 12:6114793-6114815 CTGCGGTAGGTGAAGCTCCAAGG - Intronic
1092418308 12:8308801-8308823 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1096370302 12:51063843-51063865 GTGCGGAAGGGGAGGCTTGAGGG + Exonic
1096828234 12:54295381-54295403 TTCCCTCAGGGGAAGCTGGAGGG - Exonic
1097726249 12:63078757-63078779 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1097848646 12:64390528-64390550 CTGCGCGCGGGGAAGCCGGACGG + Exonic
1098696005 12:73555690-73555712 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1100293069 12:93235786-93235808 CAGTGGGAAGGGAAGCTGGAAGG - Intergenic
1100511177 12:95275485-95275507 CTGAGGCAGGAGAACCCGGAAGG + Intronic
1101253809 12:102958279-102958301 CTGCGGCTGGGGCTGCTGGCCGG - Exonic
1101829522 12:108246510-108246532 GTGCAGAAGGGGAACCTGGATGG - Intronic
1102192814 12:111001843-111001865 CTAGGACAGGGGGAGCTGGAAGG - Intergenic
1102295036 12:111729905-111729927 CTGCTGACGGGGAAGATGGAGGG - Exonic
1102373719 12:112404132-112404154 CTGAGGCAGGAGAATTTGGACGG - Intergenic
1102547024 12:113664574-113664596 CTACGGCAGGGGAGCCAGGAGGG - Intergenic
1103572581 12:121854892-121854914 CTGGGGCTGGAGAAACTGGAGGG - Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103912586 12:124360558-124360580 GTGTGGCAGGGGCTGCTGGAGGG - Intronic
1104377531 12:128278091-128278113 CTGCGGCATGAGAAACTGGCAGG - Intronic
1104808774 12:131607209-131607231 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1105800406 13:23898147-23898169 CTGCTGCGGGGGAAACTGCATGG - Intronic
1106597801 13:31161636-31161658 CGGCGGCAGGAGAAGCAGGCAGG - Exonic
1108687799 13:52835916-52835938 CTGCCCCAGGGGATGCTGGTTGG - Intergenic
1109285403 13:60402785-60402807 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112498989 13:99927839-99927861 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1112982554 13:105403756-105403778 CTGTGGGAAGGAAAGCTGGAAGG + Intergenic
1113582744 13:111440454-111440476 GAGCTGCAGGGGAAGCTGCAGGG - Intergenic
1113582751 13:111440478-111440500 GAGCTGCAGGGGAAGCTGCAGGG - Intergenic
1113582758 13:111440502-111440524 GAGCTGCAGGGGAAGCTGCAGGG - Intergenic
1113582765 13:111440526-111440548 GAGCTGCAGGGGAAGCTGCAGGG - Intergenic
1113582772 13:111440550-111440572 GAGCTGCAGGGGAAGCTGCAGGG - Intergenic
1113582779 13:111440574-111440596 GAGCTGCAGGGGAAGCTGCAGGG - Intergenic
1113582798 13:111440634-111440656 GAGCTGCAGGGGAAGCTGCAGGG - Intergenic
1117328709 14:54691705-54691727 CGGCTGGAGGGGAAGCAGGAAGG + Intronic
1117689307 14:58289836-58289858 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1119391776 14:74295863-74295885 GTGCATCAGGAGAAGCTGGAGGG - Exonic
1122108733 14:99480727-99480749 CTGCGCTAGGGGAAGCGGGCAGG - Exonic
1122545042 14:102517324-102517346 CTGGGGGAGGGGAACCCGGAAGG - Intergenic
1122686462 14:103510356-103510378 CCGGGGCAGGGGCAGCTGGGGGG - Intergenic
1122787080 14:104168774-104168796 CGGGGGCAGGGGAAGCTGTGTGG + Intronic
1123069717 14:105636532-105636554 GTGGGGCAGGGGCACCTGGAAGG + Intergenic
1123088799 14:105732251-105732273 GTGGGGCAGGGGCACCTGGAAGG + Intergenic
1123108797 14:105855662-105855684 CTGCGCGAGGGGAAGCAGGTGGG - Intergenic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1125933153 15:43614206-43614228 ATGCTGCAGGGGAAGCTGCAGGG - Exonic
1125946251 15:43713668-43713690 ATGCTGCAGGGGAAGCTGCAGGG - Intergenic
1127868253 15:63048773-63048795 CTGCGGGGGGGGAAGCAGGAGGG - Intronic
1127957479 15:63865520-63865542 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1128017577 15:64360790-64360812 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1129263290 15:74380938-74380960 CAGGGGCAGAGGAAGCTGGTGGG - Intergenic
1131406141 15:92166542-92166564 GTGAGTGAGGGGAAGCTGGAGGG - Intronic
1131848037 15:96508891-96508913 GTAGGGCAGGGGAACCTGGAAGG + Intergenic
1132203108 15:99968675-99968697 CTGGGGCCGGAGAAGATGGATGG - Intergenic
1132303052 15:100788263-100788285 CTGCTGCAGGGGAAGTAGCAGGG - Intergenic
1132505724 16:307705-307727 CTGCAGCAGGGACAGCAGGAGGG - Intronic
1132590085 16:722751-722773 CTGAGGCTGAGGAAGCTGGCAGG - Exonic
1132731991 16:1367213-1367235 CAGCTGCAGGAGGAGCTGGAGGG - Intronic
1132815196 16:1822493-1822515 CTGGAGCAGGGCAAGCTGGCAGG - Intronic
1133040344 16:3057248-3057270 CTGCTGCAGAGGACACTGGATGG - Intronic
1133219126 16:4311264-4311286 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1133220449 16:4317170-4317192 CTGGGGCCTGGGAAGCTGGAAGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1134070296 16:11256170-11256192 CTGCGGCCGTGGCAGCTGCACGG - Exonic
1135291766 16:21245561-21245583 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1136144317 16:28307028-28307050 CTGGGGCTGGGGCTGCTGGAGGG - Intronic
1136367220 16:29814345-29814367 CTGCAGCAGGGGGACGTGGACGG + Exonic
1137556140 16:49471603-49471625 ACGAGGCAGGGTAAGCTGGAAGG - Intergenic
1139377586 16:66509828-66509850 CTGCGGCAGGCAGAGCTGGTGGG - Exonic
1141490963 16:84372521-84372543 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1141551306 16:84808490-84808512 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1141860148 16:86710872-86710894 GTGGGGCAGAGGAGGCTGGAGGG + Intergenic
1142115347 16:88353429-88353451 GTGGGGCTGGGGAAGCTGGGTGG - Intergenic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1143247641 17:5500040-5500062 GCGCAGCAGGCGAAGCTGGAGGG - Intronic
1143360516 17:6365447-6365469 CTTCTGCAGGGAAAGCAGGAAGG - Intergenic
1143864040 17:9911186-9911208 CTGCTGCAGGTGATGCTGGAAGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144789200 17:17848080-17848102 GTGGGGCAGGGTAAGCTGGAGGG + Intronic
1144816871 17:18040614-18040636 CTGGGGGTGGAGAAGCTGGAAGG - Intronic
1145065669 17:19759796-19759818 CTGCTGGAGGAGAAGCGGGAAGG + Intergenic
1145173977 17:20684500-20684522 CTGAGGCAGGAGAATCTGGCAGG - Intergenic
1145264179 17:21371662-21371684 CTGCGGGAGGAGCAGCTGGGAGG - Intergenic
1145831697 17:27921424-27921446 CTGCTGCTGGGGCAGCTAGAGGG - Intergenic
1145961390 17:28888293-28888315 CAGCGGCAGGTAGAGCTGGATGG + Intronic
1146260021 17:31415011-31415033 CTCCAGCAGGGGAAGCAGGGAGG + Intronic
1146391558 17:32427997-32428019 CTTCGGGAGGCCAAGCTGGAAGG + Intergenic
1146445254 17:32928015-32928037 CGGCGGCCGGGGCAGCTGGGAGG - Exonic
1146594535 17:34157318-34157340 CTGGGGCGGGGGAAGCAGGCAGG - Intronic
1146948240 17:36888686-36888708 CTGGGGCAGCTGAAGCTGGGAGG - Intergenic
1147568974 17:41555729-41555751 CAGCTGCAAGGGAGGCTGGAAGG - Intergenic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1147630103 17:41924713-41924735 CTGCCACCAGGGAAGCTGGAGGG + Intronic
1147899551 17:43775056-43775078 ATGAGGCAGGAGAAGCTGGCAGG - Intronic
1147985236 17:44302765-44302787 CTGAGGCAAGAGAATCTGGAAGG + Intergenic
1148122542 17:45221638-45221660 CTGCGGCAGGTGAAGCGGCTCGG + Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148582501 17:48753273-48753295 GGGTGGCGGGGGAAGCTGGAGGG + Intergenic
1148679478 17:49465541-49465563 GGGCGGGCGGGGAAGCTGGACGG - Intronic
1148805132 17:50260066-50260088 CTGAGACTGGAGAAGCTGGAGGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149599655 17:57885293-57885315 CTGCTGCAGATGAACCTGGAGGG - Exonic
1150251248 17:63705922-63705944 CGGTGGTAGGGGCAGCTGGAGGG - Intronic
1151114831 17:71724075-71724097 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1151738458 17:75961668-75961690 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1152303515 17:79508631-79508653 CTGGGGCAGAGGACGCTGGCTGG - Intronic
1152680253 17:81664199-81664221 CTGCGGCTGAAGGAGCTGGAAGG + Intergenic
1152704639 17:81836641-81836663 CTGCAGCACTTGAAGCTGGATGG + Intergenic
1155557368 18:27034642-27034664 CTGAGGCAGGGCAAGCTTGGTGG - Intronic
1155913999 18:31537902-31537924 CTGAGGCAGGTGAACCTGGGAGG + Intronic
1155964606 18:32024290-32024312 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1156664575 18:39390076-39390098 CTGGAGCCAGGGAAGCTGGATGG + Intergenic
1156736140 18:40262218-40262240 CTGAGGCAGGGGAACCCGGGAGG + Intergenic
1157605716 18:48924712-48924734 CTGCTGGTGGGGGAGCTGGAGGG - Intronic
1158406599 18:57165471-57165493 CAGAGTCAGGGGCAGCTGGATGG - Intergenic
1159046519 18:63373986-63374008 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1160506073 18:79427494-79427516 GTGGGTCGGGGGAAGCTGGACGG + Intronic
1160892889 19:1388462-1388484 GTGCGGCTGGGGGAGCTGGAGGG + Intronic
1160978699 19:1806719-1806741 CGGGGGCAGGAGAGGCTGGACGG - Intronic
1161130122 19:2583470-2583492 CTGGGGCGGGCAAAGCTGGAGGG - Intronic
1161130572 19:2586245-2586267 CTGGGGCGGGCAAAGCTGGAGGG - Intronic
1161160295 19:2757877-2757899 CTCCTGCAGGGGAAGGTGAAGGG - Intronic
1161379850 19:3959123-3959145 CTGGAGCAGGAGAAGCTGCAGGG - Exonic
1161480578 19:4508363-4508385 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1162412846 19:10517114-10517136 CTGCTGCCGGGCAAGCTGGGCGG - Intronic
1162905313 19:13819513-13819535 CAGTGGCAGGGGGAGCTGGGGGG + Intronic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1163905253 19:20146720-20146742 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1164435099 19:28222126-28222148 AAGGGGCAGTGGAAGCTGGAGGG - Intergenic
1164477748 19:28588206-28588228 CAGGGGCAGGGAGAGCTGGAAGG - Intergenic
1164645841 19:29858347-29858369 CCCAGGCAGGGGCAGCTGGATGG - Intergenic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1165164500 19:33842047-33842069 CTGTTTCAGGGGTAGCTGGAGGG - Intergenic
1165176161 19:33931361-33931383 ATGCTGCAGGGACAGCTGGAAGG - Intergenic
1165579606 19:36850731-36850753 CCGCGCCAGGGGAATCGGGATGG + Intronic
1166301228 19:41913139-41913161 CTGCGGGAGGAGAGGCTGGGAGG - Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166374741 19:42321312-42321334 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1166872485 19:45879277-45879299 CTCAGGCAGAGGAAGCTGGCAGG - Intergenic
1167042731 19:47032261-47032283 CTGGGGCTGGGGCAGATGGAAGG - Exonic
1167455672 19:49595836-49595858 CAGCTGCAGGGGCAGCTGTATGG + Exonic
1167668823 19:50838413-50838435 CTGTGCTGGGGGAAGCTGGAGGG + Intergenic
1167716832 19:51147438-51147460 ATCCTGCAGGAGAAGCTGGATGG - Intronic
1168025976 19:53643837-53643859 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1168254783 19:55159414-55159436 GTGCGGCAGGAGCAGCTGCAGGG - Exonic
925340273 2:3131158-3131180 CTAGAGCAGGGAAAGCTGGAGGG + Intergenic
925377760 2:3400461-3400483 CTGAGGCAGGGGCAGCTGGGGGG - Intronic
925726371 2:6876231-6876253 CTACTGCAGGGGAAGCCGGCTGG - Intronic
926226840 2:10972922-10972944 CTGGTGCAGGGGAAGCGGGGTGG + Intergenic
926228663 2:10986294-10986316 CTCCAGCAGGGCCAGCTGGAAGG + Intergenic
926609056 2:14927093-14927115 GTGCTGCAGATGAAGCTGGAAGG - Intergenic
926934547 2:18073835-18073857 CTGCTGCAGAGGAAACTGGATGG + Intronic
927040570 2:19226541-19226563 GTGCGGGATGGGGAGCTGGAAGG - Intergenic
927292631 2:21419911-21419933 CTGCGGCAGGGGAAGGGACAAGG + Intergenic
927528040 2:23766604-23766626 CTGCACCAGGGAAAGCTGGATGG + Intronic
927893981 2:26769680-26769702 CTGAGGCAGAGGTGGCTGGAGGG - Intronic
927943159 2:27118532-27118554 CTGGGGGAGGGGCAGCTGGCGGG - Intronic
927963486 2:27255164-27255186 CTGAGGCTGGGGAAACTGGCAGG + Exonic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928406382 2:31018186-31018208 CTGGGCCAGGGGTACCTGGAGGG - Intronic
929464299 2:42130902-42130924 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932610015 2:73191944-73191966 CAGGTGCAGGGGAAGCAGGAGGG + Intergenic
934179784 2:89610605-89610627 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
934290076 2:91684866-91684888 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936260734 2:110957958-110957980 CTGAGGCAGGAGAACCTGGGAGG + Intronic
936523250 2:113225786-113225808 AGGCGGCAGGGGAAGGTGGAGGG + Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
937305448 2:120867788-120867810 CTCAGGCGGGGGGAGCTGGAGGG + Intronic
937735820 2:125287540-125287562 CTGCTGCTGGGGAAGCTGCATGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938689787 2:133777023-133777045 CAGCGGCAGGGGAGGCTGTAAGG - Intergenic
938966351 2:136392074-136392096 CTGGGGCAGGGGAAGCAGGGAGG - Intergenic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
939989111 2:148860739-148860761 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942724944 2:178996174-178996196 CTGAGGCAGGAGAATCTGGGAGG - Intronic
943648477 2:190431604-190431626 CTGAGGCAGGGGAATCAGGCAGG + Intronic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
944215797 2:197254292-197254314 CTGAGGCAGGAGAACCTGGGAGG + Intronic
944414097 2:199466529-199466551 CAGTGGCAGGGAAAGATGGAAGG + Intronic
946355206 2:219180190-219180212 CTCCTGCAGGTGAATCTGGAAGG - Exonic
947541732 2:230984679-230984701 CTTCGGCAGTGAGAGCTGGAGGG - Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948789322 2:240369302-240369324 GTGGGGCAGGTGAAGCAGGAAGG - Intergenic
948897856 2:240935511-240935533 CAGCGGCAGGAGCAGCTGGAGGG + Intronic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
1168886901 20:1266432-1266454 CTGCGGCGGGTGCAGCTGGGCGG - Intronic
1169022476 20:2340242-2340264 CTTCAGCAGGGGAAGCAGGAGGG - Intronic
1169118584 20:3082673-3082695 CTGCGGCTGGTGCAGCTGGCCGG - Exonic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1170107034 20:12762949-12762971 CTGCAGCAGATGAAGCTGGCTGG - Intergenic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171470436 20:25366363-25366385 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1171488541 20:25500767-25500789 CTGCTGCAGAGGAGGATGGATGG - Intronic
1172134800 20:32679731-32679753 CTGAGGGAGAGGAAACTGGAGGG + Intergenic
1172399775 20:34639939-34639961 CTGCAGCAGTGGTAGCAGGAAGG + Intronic
1172421873 20:34825232-34825254 CTGCGGGCGGGGGCGCTGGAGGG - Intronic
1172457969 20:35092639-35092661 CTGCGGCAGGGCCAGCTGACCGG - Exonic
1172800494 20:37573036-37573058 CAGAGGCAGGGGAAGCTGTCAGG + Intergenic
1173580332 20:44142527-44142549 CTGCGTCAGGGGGAGCTGCCCGG - Intronic
1173725330 20:45293396-45293418 CTGGGGGAGGGGAAGCCAGACGG - Intergenic
1173975487 20:47183657-47183679 CTCCGGCAGGGCAGGCTGGTGGG + Intronic
1174274036 20:49390641-49390663 CAGCTGCAGGGGAGGCTGGGCGG - Intronic
1174505316 20:51013998-51014020 CTGCTGGAGGGAAAGCTGGGAGG - Intronic
1175381372 20:58566606-58566628 ATCCTGCAGGGGAGGCTGGATGG + Intergenic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1175823960 20:61926527-61926549 CTGCGGCAGGGGACCCTCAAGGG - Intronic
1176177548 20:63735800-63735822 CAGCTGCAGGAGAAGCTGGCAGG + Exonic
1176376867 21:6091182-6091204 CTGCGGGAGGGGAAGATGCTGGG - Intergenic
1177169163 21:17637206-17637228 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1177332886 21:19684232-19684254 CTGGAGCCAGGGAAGCTGGATGG - Intergenic
1178570880 21:33735904-33735926 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1179746608 21:43447062-43447084 CTGCGGGAGGGGAAGATGCTGGG + Intergenic
1179769849 21:43606376-43606398 CTGGGGCTGGGTGAGCTGGAGGG + Intronic
1180041676 21:45283325-45283347 ATGCGGCAGGGGGAGGTGGGGGG + Intronic
1180832249 22:18912236-18912258 CTGGGGCAGGAAAGGCTGGAGGG - Intronic
1180840885 22:18958336-18958358 CGGCGGCTGCGCAAGCTGGAAGG - Intergenic
1181060605 22:20280438-20280460 CGGCGGCTGCGCAAGCTGGAAGG + Intronic
1181067593 22:20314106-20314128 CTGGGGCAGGAAAGGCTGGAGGG + Intergenic
1181125815 22:20702020-20702042 GGGCGGCAGGGGAAGCCCGAGGG - Intergenic
1181427820 22:22855722-22855744 CTGGGTCAGGGGAGTCTGGAGGG + Intronic
1181985261 22:26796253-26796275 TTGGGGCAGAGGAAGCTGCAGGG - Intergenic
1182199218 22:28552883-28552905 CTGAGGCAGGGGAATCAGGCAGG - Intronic
1182236781 22:28883024-28883046 TTGGGGCGGGGGAAGCAGGAAGG + Intergenic
1182271179 22:29154525-29154547 CTGCCGCAGCGGGAGCTGGGCGG - Intronic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1183231473 22:36584830-36584852 CTGCCGCAGGGGAGGCTGTGAGG - Intronic
1183357079 22:37365274-37365296 TTGAGGCAGGGGGAGCTTGAGGG + Intergenic
1184038253 22:41928683-41928705 CTGCCACAGGGGATGCTGGGAGG + Intergenic
1184170896 22:42759187-42759209 CTAAGGCAGAGGGAGCTGGAAGG + Intergenic
1185195433 22:49466511-49466533 CTGCGGCAGTGAGAGGTGGAAGG + Intronic
1185276407 22:49951825-49951847 CTGGGGCAGGGCCAGTTGGAAGG + Intergenic
1203282334 22_KI270734v1_random:137541-137563 CTGGGGCAGGAAAGGCTGGAGGG - Intergenic
949157357 3:845551-845573 CTGCTGCAGGGGCAGTGGGAGGG - Intergenic
949384874 3:3489814-3489836 CTGGGGGAGGGTGAGCTGGACGG - Intergenic
950542128 3:13618979-13619001 CTGCGGCAGTGGCAGCGGGATGG - Exonic
950969014 3:17167967-17167989 CTGCGGATGGGGAAGCTGCAGGG + Intronic
951817647 3:26772509-26772531 CTGCGGCACGAGAACCTGGGAGG + Intergenic
951877357 3:27441983-27442005 CTGAGGCAGGAGAATCTGGGAGG - Intronic
953167959 3:40482144-40482166 CAGTGCCAGGGGTAGCTGGATGG + Intronic
953404622 3:42654333-42654355 CTGCGGCAGGGCGGGCTGCACGG + Intronic
954433060 3:50481496-50481518 GGGCAGCAGGGGAAGCAGGAGGG + Intronic
954529261 3:51304231-51304253 CTGGTGCTGGGGAAACTGGACGG - Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954902544 3:54032129-54032151 CTGGGGCAAGGGATGATGGATGG + Intergenic
955225053 3:57053399-57053421 CAGAGGCAGGGCAGGCTGGAGGG - Intronic
955356844 3:58238413-58238435 CTGGGGAAAGGGAAGCTGAAAGG - Intronic
955857033 3:63283905-63283927 CTGAGGCAGGAGAACCCGGAAGG - Intronic
956212217 3:66813834-66813856 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
956463737 3:69498055-69498077 ATGCTGCCGAGGAAGCTGGATGG + Intronic
956927245 3:74002710-74002732 TTGGGGCAGGGGAATCTTGAGGG - Intergenic
957279203 3:78128035-78128057 TTGGGGCATGGGAAGTTGGAGGG - Intergenic
959784810 3:110283244-110283266 CTGCAGCAGGGGTAGAGGGAAGG - Intergenic
960477265 3:118144971-118144993 CTGGAGCCAGGGAAGCTGGAAGG - Intergenic
960577353 3:119242062-119242084 CTGAGGCAGGGGAATCAGGCAGG - Intergenic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
960941405 3:122937388-122937410 CTGCTCCAGGGGACACTGGATGG + Intronic
961508806 3:127388808-127388830 CTGGGGCTGGAGAAGCAGGAGGG - Intergenic
961509431 3:127391951-127391973 CTGATGCAGGAGGAGCTGGAGGG + Intergenic
961810845 3:129520928-129520950 GTGGGGCTGGGGAAGGTGGATGG - Intergenic
961895992 3:130168015-130168037 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
962159392 3:132982868-132982890 CTGAGGCATGGGAAAATGGAAGG + Intergenic
962207563 3:133447495-133447517 CTACCTCAGGGGAAGCTGGCAGG + Intronic
962779228 3:138695852-138695874 CTGAGGCAGGAGAATCTGGGAGG - Intronic
962906100 3:139804415-139804437 GTGGGGCAGGGGAAGAGGGAAGG + Intergenic
962978846 3:140469806-140469828 GTGAGGCAGGGGAAGAGGGAGGG + Intronic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
964200281 3:154111456-154111478 CTGAGCCAGGTGAAGCTGAAAGG + Intergenic
964780778 3:160335318-160335340 CTGAGGCAGGAGAACCTGGGAGG - Intronic
965593598 3:170385889-170385911 CTGAGGCAGGAGAATCTGGGAGG - Intronic
967315466 3:188148607-188148629 ATGAGGAAGGGGAAGCTGCAGGG + Intergenic
967442788 3:189528285-189528307 CTGAGGCAGGAGAACCTGGAAGG - Intergenic
967852873 3:194095359-194095381 CATTGGCAGGGGAAACTGGATGG + Intergenic
969111886 4:4849485-4849507 CTGGGACAGGAGAAGCTAGAGGG + Intergenic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969581869 4:8070652-8070674 CTGCCACAGGGGAGGCTGGCAGG - Intronic
969675364 4:8611463-8611485 CAACTGCAGTGGAAGCTGGAGGG + Intronic
969746776 4:9078951-9078973 CGGCGGCAGCAGCAGCTGGAGGG - Intergenic
969829494 4:9783017-9783039 CTGACGCAGGGGAAGCCGGCCGG - Exonic
970573442 4:17404901-17404923 CTGGGGCAGGGGCAGCTGCATGG - Intergenic
972671099 4:41214624-41214646 CTGCGCGAGGGAAGGCTGGAGGG + Intronic
972766172 4:42153455-42153477 CTGGGGCAGGGTATGCTGGTTGG - Intergenic
973263221 4:48185954-48185976 CTGAGGCAGGAGAATCTGGCAGG - Intronic
973274117 4:48291052-48291074 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
973328974 4:48893180-48893202 CGGGGGCAGGGGAAGGTGGCTGG + Intronic
975165066 4:71169106-71169128 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
976690275 4:87861536-87861558 CCAAGGCAGGGGAAGATGGATGG - Intergenic
978403046 4:108350573-108350595 GGGCCTCAGGGGAAGCTGGATGG + Intergenic
978643265 4:110896632-110896654 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
978959798 4:114662913-114662935 CTGAGGCAGGAGAACCTGGGAGG - Intronic
982373821 4:154664800-154664822 CTGAGGCAGGAGAACCAGGAAGG - Intronic
984695489 4:182775313-182775335 GTGCAGCTGGGGAGGCTGGAGGG + Intronic
984951817 4:185013567-185013589 CTGCCGTAGCTGAAGCTGGAAGG - Intergenic
985103674 4:186482066-186482088 CTGAGGCAGCGGCAGCTGGCAGG - Intronic
985390505 4:189487677-189487699 CTGAGCCAGGGGAGGCTGAACGG - Intergenic
985493117 5:190765-190787 GTGCGGCAGGGAAAGCTGCAGGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986104211 5:4644290-4644312 CTGCGGAAGCGGCAGCAGGAAGG - Intergenic
988077196 5:26367857-26367879 CTGCAGCATGTGAAACTGGATGG - Intergenic
988273021 5:29041647-29041669 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
988969419 5:36451292-36451314 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
989172088 5:38481985-38482007 CAGCCGCAGATGAAGCTGGAGGG - Exonic
990042432 5:51390122-51390144 CTGAGGGCGGGGAAGCTGGGAGG + Intronic
990954804 5:61331547-61331569 CGGCTGGAGGGGAAGCTGGCAGG + Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991974006 5:72168208-72168230 CTGTTGCTGGAGAAGCTGGAAGG - Intronic
992397197 5:76378917-76378939 CTGAGGCAGGAGAAACCGGAAGG + Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995666173 5:114544822-114544844 CTGGAGCCAGGGAAGCTGGATGG + Intergenic
995895122 5:117002793-117002815 CTGAGGCAGGGGAATCAGGCAGG + Intergenic
996948104 5:129094500-129094522 CAGCGGCCCGGGAAGCTGGAGGG + Intergenic
997247038 5:132358481-132358503 CTGCAGGAGGGTGAGCTGGAGGG - Intergenic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
1001193884 5:169654322-169654344 TTGAGGCAGGGAAAGCAGGAAGG + Intronic
1001526751 5:172434498-172434520 CGGAGGCAGGGGAAGCAGGGCGG - Intronic
1002145901 5:177181126-177181148 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1002915718 6:1526288-1526310 CTGCCGGAGGGTAACCTGGAGGG - Intergenic
1004205604 6:13589225-13589247 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1004263472 6:14129071-14129093 CTGAGGGAGGGGTTGCTGGATGG + Intronic
1004682502 6:17909793-17909815 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1004924427 6:20403575-20403597 CGGCGGGAGGGGGCGCTGGAGGG + Intronic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006302336 6:33200267-33200289 CGGAGCCAGGGGAGGCTGGACGG - Exonic
1006638649 6:35477321-35477343 CGGCGGCAGGGGCGGCTGGATGG + Exonic
1006745763 6:36340967-36340989 ACGAGGCAGGGGAATCTGGAGGG - Intergenic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007041200 6:38724074-38724096 CTGAGGCAGGAGAATCCGGAAGG - Intronic
1007106048 6:39283723-39283745 CATCCGCTGGGGAAGCTGGAAGG - Intergenic
1007181391 6:39931799-39931821 CTGTGGCGGGGGAAGCAGGGAGG - Intronic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1007409385 6:41653216-41653238 CTGCGGCAGCGGCAGCAGCAGGG - Intronic
1007482998 6:42162494-42162516 CTGGTGGAGGGCAAGCTGGAGGG + Intronic
1008646567 6:53520474-53520496 CTGCCGCAGGCGAGGGTGGAGGG - Intronic
1010929663 6:81785920-81785942 CTGGGGCAGGGGCAGATGTATGG + Intergenic
1011190987 6:84728107-84728129 CTGCGGTAGGGAACTCTGGAAGG + Intronic
1013233325 6:108175781-108175803 CTGCGGCGCAGGAAGCCGGAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013587156 6:111589677-111589699 CAGGGGCTGGGGAAGCAGGAGGG - Intronic
1016038950 6:139411990-139412012 CAGCTGAATGGGAAGCTGGAAGG + Intergenic
1016802972 6:148185137-148185159 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1017036283 6:150270069-150270091 GAGGGGGAGGGGAAGCTGGATGG + Intergenic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018650715 6:165989134-165989156 CTGCTGCAGGAGCAGCCGGATGG + Intergenic
1019440174 7:1041952-1041974 ATGCGGCAGGGGAAGGGGAAGGG + Intronic
1019461861 7:1163671-1163693 CTGCGGCAGGAGAATCTCGGGGG + Intergenic
1019593948 7:1849802-1849824 CAGCGGCAGCGGAAGCAGGACGG + Exonic
1020326680 7:6979626-6979648 CGGCGGCAGCAGCAGCTGGAGGG + Intergenic
1020452654 7:8337509-8337531 CTGCTGCAGGAGAGACTGGAAGG - Intergenic
1020772482 7:12412123-12412145 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1022174753 7:27862350-27862372 CTGGGGCGGGGGAGGCGGGAGGG - Intronic
1022525651 7:31035329-31035351 CAGCAGCAGGGGAAGAAGGAGGG + Intergenic
1022630449 7:32079619-32079641 CTTTGGCAGGGACAGCTGGAAGG + Intronic
1023993198 7:45142679-45142701 CAGCAGCAGGGGAGCCTGGAGGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024471717 7:49773610-49773632 CTGCGGCAGGGGGAGGCGGGAGG + Intergenic
1025573152 7:62600548-62600570 CTGAGGCAGGGGAATCAGGCAGG + Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1027154395 7:75756306-75756328 CTGAGACAGGGCAAGCTGGGAGG - Intergenic
1027996374 7:85430390-85430412 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1029272445 7:99385285-99385307 ATGGGGCAGGGGAAGTTGGGTGG + Intronic
1029286374 7:99468691-99468713 CTGGGGCAGGGGAAGCTGAGGGG + Intergenic
1029821511 7:103151543-103151565 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1031198510 7:118647379-118647401 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1031843499 7:126775870-126775892 GTGCAGCAGATGAAGCTGGAGGG - Intronic
1032495065 7:132355244-132355266 TTGGGACACGGGAAGCTGGAAGG - Intronic
1032566788 7:132954819-132954841 CTCCGTCAGGGCAAGCTGTATGG - Intronic
1033666233 7:143443346-143443368 CTGCGCTTGGGGCAGCTGGAGGG + Intergenic
1034176451 7:149103824-149103846 CTGCATCAGGGGCAGCTTGAAGG - Exonic
1034254641 7:149717895-149717917 CTGAGGCAGGAGAACCTGGAAGG - Intronic
1034426351 7:151016221-151016243 CTGCTGCTGGTGAAGCTGCATGG + Exonic
1034430922 7:151040820-151040842 GGGCGGCAGGGGTAGCTGGGAGG - Exonic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1035055264 7:156031074-156031096 CTGGCCCAGTGGAAGCTGGAAGG - Intergenic
1035312407 7:157977810-157977832 CTGCTGCTGGGGGAGCAGGAAGG + Intronic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1036484101 8:9164116-9164138 CTGCTGCAGGGCAGGCAGGAAGG + Intronic
1036653775 8:10662583-10662605 CCGAGTCAGGGGAAGCGGGAGGG - Intronic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1039392095 8:37189518-37189540 GTGCTGCATGGGAAGATGGAAGG + Intergenic
1040063160 8:43121824-43121846 CTGCTGCAGAGGGTGCTGGAAGG - Intronic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1042922566 8:73934152-73934174 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1044356158 8:91225015-91225037 CTGGGGCCAGGGAGGCTGGATGG - Intronic
1045299651 8:100900101-100900123 CAGCGGCAGGGACAGCGGGATGG + Intergenic
1045354786 8:101375754-101375776 CTGCAGCACGTGAAGCAGGAAGG + Intergenic
1047254838 8:123207149-123207171 CAGAGCCAGGTGAAGCTGGAGGG - Exonic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047770477 8:128026613-128026635 CTGCACCAGGGCAGGCTGGAGGG + Intergenic
1049539090 8:143198923-143198945 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1049642255 8:143720992-143721014 CTGGGGCAGTGGAACCTGCAGGG - Exonic
1049740730 8:144239734-144239756 CTGCTGCTGGGGTACCTGGATGG + Exonic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052888785 9:33676805-33676827 CTGCGGCAGCAGCTGCTGGATGG + Intergenic
1053284868 9:36843677-36843699 TAGCAGCAAGGGAAGCTGGAAGG - Intronic
1054777043 9:69132472-69132494 GTGCTGCAGGAGAAGGTGGAAGG + Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055731895 9:79287160-79287182 CTGCGGCTGCCTAAGCTGGAAGG - Intergenic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1057164757 9:92916766-92916788 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1057796129 9:98159487-98159509 CAGGTGCTGGGGAAGCTGGAAGG - Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060483049 9:124029210-124029232 CTGTGGCAGTGCATGCTGGAGGG + Intronic
1060543328 9:124446493-124446515 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1061003740 9:127916887-127916909 ATGCGGCAGTGGAATCTGGAAGG - Exonic
1061539919 9:131272619-131272641 CTGGGGCAGGGGAGACAGGAAGG + Intronic
1062142839 9:134969297-134969319 CCAGGGCAGGGGAGGCTGGAAGG + Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062397521 9:136358432-136358454 CTGCGGCAGGGGCAGAAGGGAGG - Exonic
1062671490 9:137712396-137712418 CTGCTGCAGGGAAAGCAAGATGG - Intronic
1186454697 X:9701972-9701994 CGCCTGCAGGGGGAGCTGGATGG + Intronic
1186741029 X:12518037-12518059 CTGAGGCTGGGGAGACTGGATGG - Intronic
1187915684 X:24150225-24150247 CTGCTGCAGGGGACGATAGAGGG + Intronic
1188191285 X:27174353-27174375 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1189288137 X:39866593-39866615 CGGGGGCCGGGGAAGCTGCAGGG - Intergenic
1190261264 X:48798948-48798970 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1192451681 X:71248768-71248790 CTGCGGCGGCAGAAGCTGCAGGG + Exonic
1192624768 X:72715361-72715383 CGGCGGCGGGGGAAGCGGGGGGG - Intergenic
1192773489 X:74217521-74217543 ATGATGCAGGTGAAGCTGGAAGG - Intergenic
1192951932 X:76026425-76026447 CTGGAGCTGGGGAGGCTGGACGG + Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1194596709 X:95867923-95867945 CTGGAGCCAGGGAAGCTGGATGG + Intergenic
1195020244 X:100819806-100819828 GTGCGGCAGGGGATTCTGGCAGG - Intergenic
1197153988 X:123250122-123250144 CTGGGGCAGGGGTAGCAGGGAGG + Intronic
1197602157 X:128543462-128543484 CTGCAGCCAGGGAGGCTGGACGG - Intergenic
1197792636 X:130270786-130270808 CAGAGGCAGAGGAAGTTGGATGG - Intergenic
1199649966 X:149940444-149940466 CTGCGGGAGGAGGAGCTGGGGGG + Intergenic
1200137738 X:153883175-153883197 GTGAGGCAGGGGCAGCTGGGGGG + Intronic
1200167264 X:154045364-154045386 CTGCCACAGGGGAAGCAGCAGGG + Intronic
1200207078 X:154324234-154324256 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1200233600 X:154458166-154458188 CGGCGGCAGGGGACGCAGGCGGG - Intergenic
1200306032 X:155026911-155026933 CGGCGGCAGCGGAAGAGGGAGGG - Exonic
1200958670 Y:8975590-8975612 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1202092523 Y:21208840-21208862 CTGGAGCAAGGGAGGCTGGAGGG + Intergenic
1202302745 Y:23434977-23434999 CTGAGGCAGGGGACACTGGAAGG + Intergenic
1202568066 Y:26235617-26235639 CTGAGGCAGGGGACACTGGAAGG - Intergenic