ID: 998189197

View in Genome Browser
Species Human (GRCh38)
Location 5:140008083-140008105
Sequence AGATGTGGGGAGCACCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998189193_998189197 24 Left 998189193 5:140008036-140008058 CCTATAGTAGGAAGCTGTCACTC 0: 1
1: 0
2: 2
3: 4
4: 75
Right 998189197 5:140008083-140008105 AGATGTGGGGAGCACCACACAGG 0: 1
1: 0
2: 0
3: 13
4: 155
998189192_998189197 29 Left 998189192 5:140008031-140008053 CCAGTCCTATAGTAGGAAGCTGT 0: 1
1: 0
2: 1
3: 5
4: 76
Right 998189197 5:140008083-140008105 AGATGTGGGGAGCACCACACAGG 0: 1
1: 0
2: 0
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998189197 Original CRISPR AGATGTGGGGAGCACCACAC AGG Intronic
900428292 1:2590408-2590430 AGATGCGGGGAGCCCCACTGGGG - Exonic
900789985 1:4673531-4673553 AGCTGTGGAGGGCACCATACCGG - Intronic
900886025 1:5415936-5415958 AGATCTGGGCAGAACTACACAGG + Intergenic
909728700 1:78867874-78867896 ACATGTGCGCACCACCACACTGG - Intergenic
913473849 1:119217738-119217760 AGATGTTGGGAGCACAAAAAAGG + Intergenic
913696387 1:121329875-121329897 AGATGTCAGGAGCACCAAACGGG - Intronic
914141173 1:144950178-144950200 AGATGTCAGGAGCACCAAACGGG + Intronic
917484999 1:175447784-175447806 AGATGTGTGGAGCTCAACAAGGG + Intronic
918508223 1:185281133-185281155 ATATTTGGGTGGCACCACACAGG + Intronic
919730878 1:200912956-200912978 GGAAGTGGGGAGCCACACACAGG + Intronic
920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG + Intronic
920298252 1:204973158-204973180 TGCTGTGGGGAGCACCAGATGGG - Intronic
920483713 1:206348241-206348263 AGATGTCAGGAGCACCAAACGGG - Intronic
920531917 1:206708292-206708314 ACAGGTGGGGAACACCACAGGGG - Intronic
921323977 1:213972572-213972594 AAATGTTGGGTACACCACACAGG - Intergenic
1062871209 10:906483-906505 ACCTGTGGGTTGCACCACACTGG - Intronic
1064995910 10:21296569-21296591 CCATGTGGGGAGCAACCCACAGG + Intergenic
1067563674 10:47321720-47321742 GGATGTGGGGAGCTCCCCACAGG + Intergenic
1072855670 10:98943504-98943526 TGATGTGGGGGGTACTACACAGG - Intronic
1073073526 10:100809395-100809417 AGATGTGGGGAGAAAAAAACTGG + Intronic
1073217538 10:101844601-101844623 AGATATGGGGAGCAACTGACAGG + Intergenic
1074392958 10:113073200-113073222 AGAAGTGAGGTGGACCACACAGG - Intronic
1075547344 10:123365005-123365027 AGATGTTGGGAGCACCACGGTGG - Intergenic
1075964603 10:126600451-126600473 AGATGTGGTGAGGACCTCATGGG + Intronic
1076062622 10:127425648-127425670 TGGTGTAGGGCGCACCACACTGG + Intronic
1076592029 10:131590001-131590023 AGAGGAGGGCAGCCCCACACAGG + Intergenic
1078526371 11:12104591-12104613 AGAGGTGGCAAGAACCACACAGG - Intronic
1080299198 11:30765454-30765476 AAATGTAGGCAGCACCACTCTGG - Intergenic
1084758908 11:71256063-71256085 GGATGTGGGGAGCAGCAGGCAGG + Intergenic
1088906371 11:114158210-114158232 AGAAGTGCCCAGCACCACACAGG - Intronic
1089526660 11:119101476-119101498 AGATGTGAGCAGCGGCACACGGG - Exonic
1090731924 11:129579881-129579903 AGATGTGGTGAGCCCCTCAAGGG + Intergenic
1091032838 11:132206553-132206575 AAATGTGGAGAGCAAGACACAGG + Intronic
1094557235 12:31513171-31513193 AGGTTTGGGGAAGACCACACAGG + Intronic
1095326397 12:40898992-40899014 AGATGTGGGCATCTCCACAGTGG + Intronic
1096237006 12:49936089-49936111 AGAGGTGTGCACCACCACACCGG - Intergenic
1098267910 12:68741402-68741424 CGATGTGGGGAGGGGCACACAGG - Intronic
1101246186 12:102885976-102885998 AGCTGTGGAGATCAGCACACAGG - Intronic
1102787834 12:115618920-115618942 AGGAGTGGGGAGGACCACATGGG + Intergenic
1103925165 12:124419770-124419792 AGATGTGGGGAGACCCCCTCTGG - Intronic
1106452744 13:29897890-29897912 AGATGTGAGGAGCAGCAGAACGG + Intergenic
1108460986 13:50667033-50667055 AGATGTGGGGAATATCACATTGG + Intronic
1109136987 13:58664382-58664404 AGATGTAGGCAGCATAACACAGG - Intergenic
1112372831 13:98809946-98809968 AGATGTGGGGGTCTCCACAGAGG + Intronic
1115942724 14:38627396-38627418 AGCTGTGGGGGCCACCCCACTGG - Intergenic
1122651828 14:103230621-103230643 AGAGGTGGGGAGAGCCTCACGGG + Intergenic
1125417963 15:39473237-39473259 AGATGGGGGAGGCAGCACACTGG + Intergenic
1125428334 15:39572210-39572232 AGTACTGGGGAGCACCACCCGGG - Intergenic
1125730387 15:41889771-41889793 CCAAGTGGGGAGCACCACACAGG + Intronic
1125931224 15:43601395-43601417 AGATGGCTGGAGCACCACTCAGG - Exonic
1127124201 15:55796349-55796371 AGATGTGTGGAGCACAATGCTGG - Intergenic
1128427656 15:67558644-67558666 AGGTTTGGGGAGAAACACACGGG - Intronic
1129323689 15:74788616-74788638 AGCTGTGGGGATCAACACAAAGG - Intronic
1131947053 15:97635126-97635148 AGATGTGGTGAGGGTCACACAGG - Intergenic
1132587513 16:711980-712002 AGAGGTGGGGAGAGGCACACGGG - Intronic
1134071105 16:11260298-11260320 AGATGAGGAGAGCACAACTCAGG + Intronic
1135700766 16:24630686-24630708 TGCTGTAGGGAGCCCCACACTGG + Intergenic
1138183822 16:54961542-54961564 AGAGGTGGGGAGCAGGTCACAGG + Intergenic
1139362118 16:66406439-66406461 AGATGTGGCCAGAGCCACACAGG + Intergenic
1142122021 16:88391188-88391210 AGATGTGGAGAGCACCTCAATGG + Intergenic
1144341330 17:14312717-14312739 AGTTGTGGGGGGCAGCACAAAGG - Intronic
1147182644 17:38696232-38696254 AAATGTGGGGCGCATTACACAGG - Intergenic
1147536217 17:41324651-41324673 AGATCTGGGGAGTATCACTCGGG + Intergenic
1151527944 17:74683816-74683838 AGGAGTGGGCAGCACCACAGTGG + Intronic
1151541644 17:74767753-74767775 AGATTCAGGGAGCACCACATGGG + Intronic
1152326611 17:79645284-79645306 AGGGGTGGGGCACACCACACAGG - Intergenic
1155183153 18:23365650-23365672 AAATGCCAGGAGCACCACACTGG + Exonic
1155912075 18:31515580-31515602 AAATTTGGGGAGCACCACTTTGG + Intronic
1157708892 18:49834387-49834409 ACCTGTGGGGAGCACCTCAGGGG - Intronic
1158951325 18:62498035-62498057 AGAGGTGTGCACCACCACACTGG - Intergenic
1159216644 18:65400378-65400400 AGGTGAGGGGGGCTCCACACAGG + Intergenic
1160874897 19:1292350-1292372 AGTTGTGGGGAGCAGCCCACAGG - Intronic
1164308882 19:24029444-24029466 AGACCTGGGGAGAACCACAGTGG - Intergenic
1166378168 19:42340191-42340213 AAATGTGTGGAGCACTTCACTGG - Intronic
925049988 2:805902-805924 TGATGTGTGGAGCATCTCACGGG - Intergenic
925183433 2:1831417-1831439 AGAAGTGGGCAGGACCTCACAGG - Intronic
927959740 2:27233660-27233682 ATAGGAGGGGCGCACCACACAGG - Exonic
930232391 2:48856636-48856658 ACATGGGGGAAGCACCAGACTGG + Intergenic
935180838 2:100690027-100690049 GGATGTGTGAAGCACCACAGTGG - Intergenic
936092810 2:109511909-109511931 TGCTGTGGGCAGCACCACACTGG - Intergenic
937479706 2:122245320-122245342 AAATGTGTGGAGTAACACACAGG - Intergenic
942055131 2:172174982-172175004 AGATGTTAGGAGCCCCACCCAGG + Intergenic
943064968 2:183076041-183076063 GGATCTGGGTAGCACAACACAGG + Intergenic
943869468 2:192975544-192975566 CGATGTTGTGAGCAGCACACTGG + Intergenic
945924246 2:215787713-215787735 AGATGTGGGGAGCAGAACGAAGG + Intergenic
946368650 2:219266739-219266761 AGGTGTGGGGGGCATCACAGGGG + Intronic
946939110 2:224752516-224752538 AGCAGTGTGGAGCACCACTCTGG - Intergenic
947144397 2:227051362-227051384 AGAGGTGGGAAGGAGCACACAGG + Intronic
947736293 2:232457160-232457182 AGGAGTGGTGACCACCACACGGG + Exonic
948247620 2:236499614-236499636 AGATGGGGGTTTCACCACACTGG + Intronic
948482581 2:238259481-238259503 TGAAGTGGGGAGTACCACCCAGG - Intronic
948629988 2:239296110-239296132 AGAAAAGGGGAGCACCAAACTGG + Intronic
1170194948 20:13680301-13680323 AAATGTGGGGAGTACATCACTGG + Intergenic
1170842745 20:19937336-19937358 AGAAGTGGCGAGCACCGCCCGGG + Intronic
1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG + Intronic
1174602530 20:51736249-51736271 AGATGGGGGGCGGACAACACAGG + Intronic
1175942138 20:62542308-62542330 GGATGTGGGGAGGACCCCAAGGG - Intergenic
1178952380 21:36995536-36995558 ACATGTGTGCATCACCACACTGG - Intergenic
1180671913 22:17560358-17560380 GGGTGGGGGGAGCACCACTCTGG + Intergenic
950356534 3:12414805-12414827 AGATGTGAGGACCCCCAAACAGG - Intronic
953378027 3:42445109-42445131 ACAGGTGGGCACCACCACACCGG - Intergenic
954801711 3:53190773-53190795 AAATGTGGGGCGCATTACACAGG - Intronic
959071561 3:101706572-101706594 AGAAGTGTGAGGCACCACACTGG - Intergenic
959906084 3:111712596-111712618 AGAGCTGGGGAGCACCAGGCTGG - Intronic
960574194 3:119213666-119213688 AGAATTAGGGAGGACCACACAGG + Intronic
961595112 3:128009700-128009722 AGATGTGTGTACCACCACACAGG + Intergenic
966854045 3:184181966-184181988 AGAAGTGGGACGCACCAAACTGG + Exonic
968445230 4:649079-649101 AGCTGTGGGGAGATCCACGCTGG + Intronic
969430045 4:7148684-7148706 AGATGTGAGGTGCACCAATCTGG - Intergenic
970311999 4:14792726-14792748 AGATGTGGGGAAAACACCACAGG + Intergenic
976336815 4:83897864-83897886 AGATTTGGGGTGCATCACAGAGG - Intergenic
976432948 4:84984648-84984670 AGATGGGGGGAGCAGCCAACTGG - Intergenic
979873831 4:125862556-125862578 AGATGTGGGTAGAACAGCACTGG + Intergenic
981673148 4:147310831-147310853 AGGTGTGGGAAGCAAAACACAGG - Intergenic
981818774 4:148862178-148862200 AGAGATGGGAAGCATCACACTGG + Intergenic
983641770 4:169950030-169950052 AGAGGTGTGGAGCCACACACAGG - Intergenic
990698271 5:58446771-58446793 GGATGTGGAGAGAAACACACGGG - Intergenic
991726744 5:69543083-69543105 AGGTGTGAGCAACACCACACTGG - Intronic
991868213 5:71084791-71084813 AGGTGTGAGCAACACCACACTGG + Intergenic
992117580 5:73555521-73555543 TGATGTGGGCTGCAGCACACGGG - Exonic
992323414 5:75636649-75636671 AGAAGTGGGGAGGACCAGTCAGG + Intronic
995531368 5:113095006-113095028 AGAGGAGGGGAACACAACACTGG + Intronic
998189197 5:140008083-140008105 AGATGTGGGGAGCACCACACAGG + Intronic
998253626 5:140568728-140568750 AGGTGTGGGGAGCAGCACTGTGG - Exonic
1002121483 5:177007756-177007778 AAATGTGGGGAGAAGCAAACAGG + Intronic
1002473672 5:179452195-179452217 AGTTTTAGGGAGCACCCCACAGG + Intergenic
1003587239 6:7402971-7402993 ACATTTGGGCAGAACCACACTGG - Intronic
1004332875 6:14737505-14737527 AGATGTGGGCAGTCCCACAAGGG + Intergenic
1005099581 6:22155923-22155945 AGATATGGGGAGGATGACACTGG + Intergenic
1006312114 6:33268211-33268233 AGATGTGGGGAACCAAACACAGG + Intronic
1007426541 6:41749691-41749713 AGATATGGGGGGCAGCAGACAGG - Intronic
1011349533 6:86407417-86407439 AGATGTGGGAGGCACTTCACAGG - Intergenic
1012893130 6:104919704-104919726 AGAGGTGAGGAGCAGCACAGTGG + Intergenic
1013481918 6:110560314-110560336 AAATGTGAGGAGCAGAACACTGG - Intergenic
1016333259 6:142976088-142976110 AGAACTGGGGAGCACCAAATGGG + Intergenic
1019356785 7:584369-584391 AGGTTTGGGGTGCAACACACAGG - Intronic
1019734843 7:2645545-2645567 AGACCTGGGGAGAGCCACACTGG + Intronic
1020515009 7:9107031-9107053 AGAAGTGGAGAGCACCAAGCAGG + Intergenic
1022313581 7:29221637-29221659 ATATGTGGGGAACAACACACTGG - Intronic
1023866957 7:44242883-44242905 AGAGGTGGGGAGCAGCAGAGGGG - Intronic
1025192136 7:56903943-56903965 GTATGTTGGGAGCACCAGACAGG - Intergenic
1025679815 7:63672988-63673010 GTATGTTGGGAGCACCAGACAGG + Intergenic
1025820161 7:64955366-64955388 AGATGTGGAGAGGAGCACATCGG + Intergenic
1025997848 7:66539395-66539417 AGAGGAGGTGACCACCACACGGG - Intergenic
1026036403 7:66833161-66833183 GGAGGTGGGGAGCACCATCCTGG - Intergenic
1026037475 7:66840073-66840095 GGAGGTGGGGAGCACCATCCTGG - Intergenic
1026983085 7:74537975-74537997 GGAGGTGGGGAGCACCATCCTGG + Intronic
1026990731 7:74583929-74583951 AGAGGAGGTGACCACCACACGGG - Intronic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1030099599 7:105933795-105933817 AGAAGTGAGGCACACCACACCGG - Intronic
1032917219 7:136505574-136505596 AGATGTGTGTAGCATAACACGGG + Intergenic
1035312475 7:157978259-157978281 AGATGGCGGCAGCACCACACGGG - Intronic
1044555753 8:93560012-93560034 ACATGTGTGCACCACCACACGGG - Intergenic
1044748368 8:95393308-95393330 AGGGTTGTGGAGCACCACACTGG - Intergenic
1044891823 8:96844278-96844300 AGAGGTGGGGAGGAACACAGAGG - Intronic
1047028472 8:120850427-120850449 AGATGTGGGAAGGACCATATAGG + Intergenic
1049190712 8:141285892-141285914 TGTTGTGAGAAGCACCACACAGG - Intronic
1049301892 8:141875123-141875145 AGCAGTGGGGGCCACCACACAGG - Intergenic
1052304531 9:26991752-26991774 ACATGTGTGAACCACCACACTGG - Intronic
1185942901 X:4341005-4341027 AGATGTCGAGAGGAGCACACCGG - Intergenic
1187570429 X:20495310-20495332 AGATGTGGACAGTAGCACACTGG - Intergenic
1188411725 X:29881056-29881078 AGATGTGAGGAGGACCACAAGGG - Intronic
1191190574 X:57662282-57662304 AGGTGTGGGGGGCACCAAATGGG + Intergenic
1193391215 X:80931424-80931446 AGCTGTAGGGACCACCACATTGG - Intergenic
1195936690 X:110132357-110132379 GGATTGGGGGAGCAGCACACAGG - Intronic
1197210164 X:123821665-123821687 AGAAGTGGGGATCACCATATGGG + Intergenic
1198101512 X:133426189-133426211 ACAGGTGGGCACCACCACACCGG + Intergenic
1199693208 X:150324837-150324859 AGGGGTGGGGAGCATGACACAGG - Intergenic
1199722045 X:150549189-150549211 ATTTGAGGGGAGCACCAGACTGG - Intergenic