ID: 998192448

View in Genome Browser
Species Human (GRCh38)
Location 5:140038386-140038408
Sequence CTGGAGAATAAAGATCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998192448_998192452 27 Left 998192448 5:140038386-140038408 CCAGCAAGATCTTTATTCTCCAG 0: 1
1: 0
2: 0
3: 17
4: 209
Right 998192452 5:140038436-140038458 CACAATGATTAAGCACATTGTGG 0: 1
1: 0
2: 0
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998192448 Original CRISPR CTGGAGAATAAAGATCTTGC TGG (reversed) Intronic
904248619 1:29206153-29206175 ATGGAGAATAAAGAACGTGGAGG - Intronic
909124903 1:71655540-71655562 ATGCAGAATAAAAATTTTGCAGG + Intronic
909169354 1:72274874-72274896 CTGTGGAATAATGATCTGGCAGG - Intronic
910197507 1:84659179-84659201 TTGAACAATAAAAATCTTGCTGG + Intronic
911136429 1:94445633-94445655 CTGGAAAAGAAAGATCTGGAGGG - Intronic
912368068 1:109151177-109151199 CTAGAGAATCAGGATCTTGGTGG + Intronic
913481616 1:119294392-119294414 CTGGAGATTAATGTTCATGCAGG + Intergenic
915179775 1:154048205-154048227 CTGGAAAAGAAAGATCTGGAGGG - Intronic
916316983 1:163459914-163459936 CTGGAAAATAAAGACATTTCTGG - Intergenic
916960691 1:169885523-169885545 CTAGAGAACAAAGATCTTCAGGG + Intronic
917047334 1:170875753-170875775 CTAGAGAAAAAAGACCTTTCAGG - Intergenic
918005437 1:180537460-180537482 AAGGAGAAAAAATATCTTGCAGG + Intergenic
919135191 1:193498635-193498657 CTCGAAAATAAAAATCTTCCAGG - Intergenic
920144149 1:203843742-203843764 CTGGATAATAAAGATAAGGCTGG - Intronic
920427730 1:205891554-205891576 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
923144506 1:231188450-231188472 CTGGAGAATAAAGATGCAGCTGG + Intronic
923917653 1:238527342-238527364 ATGGAGAAGAAAGGTCTTCCAGG - Intergenic
1063403245 10:5768235-5768257 CTGTGGAATAATGATCTGGCAGG + Exonic
1064126519 10:12666265-12666287 CTGGAGAATATATATGTTCCAGG - Intronic
1064783730 10:18871036-18871058 CTGGAGTATAAAGGTCATGAGGG - Intergenic
1065918598 10:30371937-30371959 CAGGAGCACAAAGAGCTTGCTGG - Intronic
1069226154 10:65947519-65947541 CTGGACAATAAATACCTTCCAGG - Intronic
1069289660 10:66762447-66762469 CTGGAGAATCTAGATCTTTGTGG - Intronic
1070026581 10:72637775-72637797 CTGGGGCAAAAAGATCTTTCTGG + Intergenic
1072211326 10:93249234-93249256 CTGGAAAATAAAGATCAAACAGG - Intergenic
1073533462 10:104254281-104254303 TTTTAGAGTAAAGATCTTGCGGG + Intronic
1079143088 11:17826889-17826911 CTGGAGAATAAAGATAATCTAGG - Intronic
1079567872 11:21904703-21904725 CTGGAGAATAAAAATGTAGGGGG + Intergenic
1080216249 11:29844641-29844663 CTGGGGAAGAAAGCTCCTGCTGG + Intergenic
1085053021 11:73389369-73389391 ATGGAGAATGAAGGGCTTGCTGG + Intronic
1085775760 11:79365258-79365280 CTAAAGAATAAAGAGTTTGCTGG + Intronic
1086409932 11:86534877-86534899 GTGGAGAATAAGCTTCTTGCAGG + Intronic
1086937243 11:92758584-92758606 CTTGAGGACAAAGATCTGGCTGG - Intronic
1087584284 11:100098701-100098723 CAGGAGAATAACCATTTTGCTGG - Intronic
1088491955 11:110397073-110397095 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1091039271 11:132261688-132261710 CTGGAGAATAGATAGGTTGCAGG + Intronic
1092774189 12:11928172-11928194 CTGCAGAATCAGGGTCTTGCAGG + Intergenic
1094268422 12:28585000-28585022 CTGGAGAAGAAAGACCTAGCAGG - Intergenic
1095912997 12:47447876-47447898 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1099340323 12:81423596-81423618 CAGCACAATAAAGATCATGCGGG + Intronic
1100285127 12:93157993-93158015 CTGGAGATGAACGATCATGCCGG - Intergenic
1100414365 12:94356420-94356442 CTGGAAAAGAAAGATCTGGGGGG - Intronic
1100811478 12:98343094-98343116 CTGGAGCAAAAAGATCTGACTGG - Intergenic
1101068663 12:101049929-101049951 CTGGAGAATAAGAATCTGGGTGG - Intronic
1101286134 12:103314504-103314526 CTTGAGAATAAAAATCTTCTGGG + Intronic
1102538026 12:113596227-113596249 CTGGAGAGTAGAGACCTTCCTGG + Intergenic
1105352352 13:19627185-19627207 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1107040086 13:35938778-35938800 CTGGACACTAAAGGTCTTGGAGG - Intronic
1110754419 13:79154850-79154872 CTGGAAAACAAACATCTTACTGG + Intergenic
1112780745 13:102898068-102898090 CTGGGGCCTAAAGATCATGCTGG - Intergenic
1114393221 14:22332378-22332400 CTGGTGAATAGAGATGTAGCGGG - Intergenic
1115714884 14:36092679-36092701 ATGGAGAAAGAAGATCTTGGTGG - Intergenic
1115730999 14:36269890-36269912 CTGGAGAAAAACAATCTTGCAGG - Intergenic
1116076873 14:40121957-40121979 CTGGAGAATAAAAACTTGGCAGG - Intergenic
1116238689 14:42313312-42313334 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1117239865 14:53819380-53819402 CTGAAGAATAAAGAGCTGGGTGG - Intergenic
1118380281 14:65212437-65212459 CTAGAGAATAAAAATATTGTGGG + Intergenic
1120640525 14:87005886-87005908 CTGGGGAATTTAGATCTTGCAGG - Intergenic
1122652794 14:103234859-103234881 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1128593708 15:68925905-68925927 CTGGAGATTGAAGATTGTGCTGG + Intronic
1129980763 15:79867497-79867519 CAAGAGAATAAAGATTTAGCTGG - Intronic
1130523227 15:84680725-84680747 CTAGAGAAAAAAGATGTTGTGGG - Exonic
1132348298 15:101121665-101121687 CTGGGGAATAAAGATGTTCTTGG - Intergenic
1133570838 16:7038456-7038478 CTGGAGAATAAAAATGTACCTGG + Intronic
1135223727 16:20637409-20637431 CTGGGGAATGAAGATCAAGCCGG - Exonic
1135532275 16:23265007-23265029 CTGGAGATGAAAGATTTTTCTGG - Intergenic
1140594358 16:76391495-76391517 CTAGTAAATAAAGATCTGGCTGG + Intronic
1140618856 16:76702519-76702541 ATAGAGAATAAAGATATTGATGG - Intergenic
1142620857 17:1165092-1165114 CTAGAGCATAAATAACTTGCTGG + Intronic
1142844728 17:2664126-2664148 CTGGAACATAAAGTTTTTGCTGG + Intronic
1143265305 17:5632416-5632438 CTGGAGAAGCAGGCTCTTGCTGG + Intergenic
1144108513 17:12008818-12008840 CTGAATAATAAGGATCTTGTGGG - Intergenic
1146945247 17:36869190-36869212 CTGGGGAACCAAGATCTTGGTGG + Intergenic
1147895513 17:43748734-43748756 CTAAAGAATAAAGATGTGGCGGG + Intergenic
1153464467 18:5373962-5373984 CTGTCGACTAAAGGTCTTGCTGG + Intergenic
1156760233 18:40580437-40580459 CTGGAGAATGAACATCTGCCTGG - Intergenic
1157323140 18:46649332-46649354 CTGGAGAATCCAGCCCTTGCTGG + Intronic
1159098571 18:63934649-63934671 CTGCAGAAAAAAGATTTTGAAGG + Intronic
1162672369 19:12267687-12267709 TTTGAAAATAAAGATCTTGAAGG - Intronic
1164025071 19:21344419-21344441 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1164032239 19:21418153-21418175 CTGGAAAAGAAAGATCTGGAGGG + Intronic
1164925367 19:32125807-32125829 CAAGAGAAAAAAGATGTTGCAGG + Intergenic
1165866213 19:38940953-38940975 CTGGAAAAGAAAGATCTGGAGGG + Intronic
927117942 2:19923605-19923627 CTGGAAAAGAAAGATCTGGAGGG - Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
928997648 2:37311180-37311202 CTGGAGAAATAAGCTTTTGCTGG - Intronic
929292483 2:40209387-40209409 CTGGAGAAAAATGATCCTGGAGG + Intronic
930183205 2:48385382-48385404 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
933412301 2:81941433-81941455 CTGGAAAATAAAGAGATTTCAGG + Intergenic
935026011 2:99277716-99277738 CTGGAAAAGAAAGATCTGGAGGG + Intronic
935140479 2:100348978-100349000 TTGGTGAGTAAAGATCCTGCAGG - Intergenic
935182270 2:100701672-100701694 CTGGAGATGGAAGATCCTGCTGG - Intergenic
936799677 2:116252212-116252234 CTGGAAAAGAAAGATCTGGCGGG - Intergenic
937409488 2:121660686-121660708 CTTGAGCATAAAGAACTTTCTGG + Intergenic
938942380 2:136180578-136180600 CTGGATGAGAAAGACCTTGCTGG - Intergenic
939706392 2:145458598-145458620 GTGGAGGAGAAAGCTCTTGCAGG - Intergenic
940310981 2:152278883-152278905 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
941440954 2:165535660-165535682 AGAGAGAATAAAAATCTTGCTGG + Intronic
946206563 2:218113123-218113145 CTGGAAAAGAAAGATCTGGAAGG - Intergenic
946294805 2:218775509-218775531 CTGTAAAATAAAGATGTTTCTGG - Intergenic
946679498 2:222198078-222198100 CTGGAGAAAAAAGATCTACAGGG + Intergenic
947009155 2:225546879-225546901 CTGCTGATTAAAGAGCTTGCAGG - Intronic
948489044 2:238299815-238299837 CTTGAGAACAAACACCTTGCAGG - Intergenic
1169339476 20:4785437-4785459 CTGGAGAATAAAGCCGCTGCTGG - Intronic
1172902299 20:38344115-38344137 CTGGAGCATAAGGATCTTATGGG - Intergenic
1173066909 20:39721878-39721900 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1176897379 21:14397191-14397213 CTAGAGAAAAAAGATCTTCAAGG - Intergenic
1177024574 21:15906259-15906281 CTGGAGTACACTGATCTTGCTGG + Intergenic
1178207886 21:30491624-30491646 TTGGACAACAAAGATCATGCTGG - Exonic
1179289727 21:40008002-40008024 CTTGAGAATAAAACCCTTGCAGG + Intergenic
1182016601 22:27045522-27045544 CTGGAGGCTAAAGATCTTGGTGG - Intergenic
949673012 3:6422012-6422034 CTGGAGGATAAAGCCCTTGAAGG - Intergenic
949897726 3:8781471-8781493 ATGAAGAAAAAAGATCTTGCCGG + Intronic
952728623 3:36616146-36616168 CTGGAGGATGATGATCTTGAAGG - Intergenic
955543317 3:60000955-60000977 CTGGAGAAGAAAGACCATTCTGG - Intronic
957571557 3:81953142-81953164 CTGGAGCATTAAGAACTTGGGGG + Intergenic
959608901 3:108271959-108271981 CTGCTGACTCAAGATCTTGCTGG - Intergenic
960745191 3:120879968-120879990 CTGGAGAATAGTGATTTGGCTGG - Intergenic
961377910 3:126479154-126479176 CTGGAGAGTACAGGTCTGGCTGG - Intergenic
961662632 3:128477752-128477774 CTGGTGAATAAAGATCCTGGTGG + Intergenic
961760413 3:129163038-129163060 CTGGAGAAAATAGATCCTGCTGG + Intergenic
961859330 3:129902102-129902124 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
964027333 3:152091757-152091779 CTGGAGAACAAAAATCTCACAGG - Intergenic
964973318 3:162587650-162587672 GTGGAGAATAAAGATATTATTGG - Intergenic
965315293 3:167183047-167183069 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
967306261 3:188062697-188062719 CTGGAGAATACAGATCCGGAAGG - Intergenic
967754033 3:193148296-193148318 CTGGAGAAATAAGATCTTTTTGG + Intergenic
969895678 4:10302377-10302399 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
972153377 4:36124596-36124618 CTGGAGAATAAAGGATGTGCAGG - Intronic
973008448 4:45042920-45042942 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
974500645 4:62697069-62697091 CTGAGAAATAAAGAGCTTGCAGG - Intergenic
974803944 4:66856235-66856257 CTGGAGAATGAGAATCTTGTGGG - Intergenic
974932559 4:68375609-68375631 CTGGAGAAAAAAGATGTGGGAGG - Intergenic
977640339 4:99350839-99350861 CCAGAGAATAAAGATCAGGCCGG + Intronic
977856980 4:101906488-101906510 CTGGAAAATAAAGATCTGGAGGG + Intronic
978905826 4:114004535-114004557 CAGGAGAAGTCAGATCTTGCAGG - Intergenic
979144112 4:117218992-117219014 CAGTAGAATAAAGCCCTTGCTGG - Intergenic
979214225 4:118143682-118143704 TTGGAGAATAAAGTACTTACAGG - Exonic
979335638 4:119458014-119458036 CTGGAGAATACAAATCTGGGAGG - Intergenic
979602395 4:122600689-122600711 CTACAGAAAATAGATCTTGCTGG - Intergenic
979893598 4:126131606-126131628 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
980140452 4:128909798-128909820 CTGGAGCATAAAGAACTTGAAGG + Intronic
983794578 4:171845232-171845254 CTGGAGGACAAAATTCTTGCTGG + Intronic
983931952 4:173462010-173462032 GAGGAGAAAAAAGATCCTGCAGG + Intergenic
984061052 4:174989500-174989522 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
984170605 4:176354457-176354479 CTGGAAAAAAAATAACTTGCAGG + Intergenic
984956488 4:185050829-185050851 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
985195643 4:187426183-187426205 CTAGAGAATAAATATCTAGAAGG - Intergenic
985500726 5:243003-243025 CTGGAAAAGAAAGATCTGGAGGG - Intronic
987100282 5:14585100-14585122 CTAGAGAGTAAAGACCTTGAAGG - Intronic
988811141 5:34786370-34786392 CTGGAAAAGAAAGATCTGGAGGG + Intronic
989758715 5:44987099-44987121 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
991156228 5:63439666-63439688 GGAGAGAATAAAGATCTAGCCGG + Intergenic
992190839 5:74290248-74290270 CTGGAGAATCAGGATCTTTAAGG - Intergenic
992509725 5:77421030-77421052 GTGGAGAATAACAATCTTTCAGG + Intronic
993405850 5:87511188-87511210 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
995986432 5:118180773-118180795 ATGAAGAATAAAGACCTTGAGGG + Intergenic
997041579 5:130262283-130262305 CTACAGAAAAAAAATCTTGCTGG + Intergenic
998192448 5:140038386-140038408 CTGGAGAATAAAGATCTTGCTGG - Intronic
1000425231 5:161082378-161082400 CTGGAGAATCATGATGTTCCAGG + Intergenic
1001583905 5:172819896-172819918 TTGGAAAATAGAGATCTGGCTGG + Intergenic
1004924684 6:20404520-20404542 TTGGAGAATCAAGATTTTGCGGG + Intronic
1005384882 6:25276257-25276279 TTGGTTAATAAAGATCTTTCAGG - Intergenic
1005500716 6:26426770-26426792 CTGCATCATAAGGATCTTGCAGG - Intergenic
1008055545 6:46942053-46942075 CTGGAGAACACAGTGCTTGCAGG - Intronic
1008093535 6:47315895-47315917 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1009590782 6:65667707-65667729 CTTGAGACCAAAGATTTTGCTGG + Intronic
1011949155 6:92942705-92942727 CTGGAGAATAAATATCCTGAAGG - Intergenic
1012267511 6:97163973-97163995 ATGGACAAAAAAGATATTGCAGG + Intronic
1013475144 6:110500036-110500058 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1013769813 6:113615367-113615389 CTAGAGAATTAAGATATTTCTGG + Intergenic
1015218356 6:130776289-130776311 ATGCAGAATAAAGATGTAGCTGG - Intergenic
1023604490 7:41916716-41916738 CTGTAGAATAAATATCAGGCTGG + Intergenic
1023676551 7:42636075-42636097 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1023804673 7:43864116-43864138 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1024399052 7:48902924-48902946 CTGTGGAATAATGATCTGGCAGG + Intergenic
1024694449 7:51840471-51840493 CTGGAGAATACAAATATTGAAGG + Intergenic
1026024085 7:66731414-66731436 CTGGTAAATAAGGATCTTGGAGG + Intronic
1026569941 7:71520695-71520717 ATGGAGAATAAAGAGTTTGCCGG - Intronic
1028780328 7:94728426-94728448 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1029233671 7:99093447-99093469 CTGGAAAATAAAGATTCTCCTGG + Intronic
1031198154 7:118642980-118643002 ATGGAGAATAAAGTGCTTCCAGG - Intergenic
1031490175 7:122377692-122377714 CTGGAGAATCAAGTTCTTTGAGG - Intronic
1031792307 7:126121657-126121679 GTGGAGAAGAAAGATCTTAGAGG + Intergenic
1032742590 7:134753724-134753746 CAGGAGAATAAAGAACATGAAGG - Intronic
1034246809 7:149651117-149651139 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1036982867 8:13490416-13490438 CTGTAGAATAGAGATCTTGTTGG + Intronic
1038923691 8:32114254-32114276 CTGCAGGAGAAAGATGTTGCAGG - Intronic
1040608920 8:48963146-48963168 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1042338684 8:67656170-67656192 CTGGAGAAGAAAGGGCTGGCTGG + Intronic
1042854391 8:73251375-73251397 CAGGAGAATAAAATACTTGCAGG + Intronic
1045460633 8:102422446-102422468 CTGGAAAATAAATATTTTGAAGG + Intergenic
1046970117 8:120213964-120213986 TTTGACAATAAAGATCTTGTAGG - Intronic
1047562894 8:126008579-126008601 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1048555564 8:135472540-135472562 TTGGAGAATAAAGCTAATGCAGG + Intronic
1048686663 8:136911976-136911998 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1049857480 8:144871913-144871935 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1050093352 9:2038468-2038490 CTGGAGAATAATAATCTTTAGGG + Intronic
1050475597 9:6037427-6037449 TTGGAAAATAAATATATTGCTGG + Intergenic
1050806295 9:9682727-9682749 CTGGAGAGGAAAGTTCTTGCTGG - Intronic
1051142193 9:13989474-13989496 CTGGAGTATATAGAACTTTCAGG + Intergenic
1052106944 9:24530458-24530480 CTAGTGAATAAAGAACTTCCTGG - Intergenic
1052278999 9:26711529-26711551 CAGGGGAAAAAAAATCTTGCCGG - Intergenic
1056109051 9:83376210-83376232 TTGGAGAATAAAGAACTTACTGG - Intronic
1056452620 9:86730757-86730779 CTGGAGAATAAGGAGAATGCAGG - Intergenic
1056910955 9:90700194-90700216 CTGGAGAATGATGATCTGGGAGG + Intergenic
1058767564 9:108196892-108196914 CTGGATAATAAAGACATTGTTGG + Intergenic
1059878676 9:118665442-118665464 CTGAAAAAAAAAAATCTTGCAGG - Intergenic
1060388820 9:123260173-123260195 CAGGGGAATAATGATGTTGCAGG + Intronic
1186451703 X:9679545-9679567 CAGGAGAACAAAGAGCTTGGTGG - Intronic
1188211954 X:27437137-27437159 CTGGAAAAAAAAAATCTTGTAGG + Intergenic
1188550049 X:31353598-31353620 TGGGAGAATGAAGATATTGCTGG + Intronic
1192312644 X:70029380-70029402 CTGGAGAATAAAGCTCAGACAGG + Intronic
1192884665 X:75324057-75324079 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1193048671 X:77078771-77078793 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1194536240 X:95108390-95108412 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1197035869 X:121871932-121871954 TTGGAGAAAAAAAATCTTCCTGG + Intergenic
1197170529 X:123428884-123428906 CCACAGAATAAAGATCTTGATGG - Intronic
1199412858 X:147545078-147545100 CTGGAGAATGAACAACTTGAAGG + Intergenic
1199729741 X:150620265-150620287 CTGATGAAGCAAGATCTTGCAGG - Intronic
1200760965 Y:7038789-7038811 CAAGAGAATAAAGAGCTTGGTGG - Intronic
1201370038 Y:13253376-13253398 CTGGAAAAGAAAGATCTGGAGGG - Intronic
1201926545 Y:19293924-19293946 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1202164089 Y:21968590-21968612 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1202227267 Y:22617774-22617796 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1202315855 Y:23577880-23577902 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1202554910 Y:26092194-26092216 CTGGAAAAGAAAGATCTGGAGGG - Intergenic