ID: 998193160

View in Genome Browser
Species Human (GRCh38)
Location 5:140043559-140043581
Sequence CAGGGCGTGCCCCCTGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998193157_998193160 0 Left 998193157 5:140043536-140043558 CCTATGAACGTGGTAATGGGACG No data
Right 998193160 5:140043559-140043581 CAGGGCGTGCCCCCTGCCTTTGG No data
998193152_998193160 11 Left 998193152 5:140043525-140043547 CCTGGCACCATCCTATGAACGTG No data
Right 998193160 5:140043559-140043581 CAGGGCGTGCCCCCTGCCTTTGG No data
998193154_998193160 4 Left 998193154 5:140043532-140043554 CCATCCTATGAACGTGGTAATGG No data
Right 998193160 5:140043559-140043581 CAGGGCGTGCCCCCTGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998193160 Original CRISPR CAGGGCGTGCCCCCTGCCTT TGG Intergenic
No off target data available for this crispr