ID: 998197126

View in Genome Browser
Species Human (GRCh38)
Location 5:140083849-140083871
Sequence GTTTTATTGGAACCAGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998197122_998197126 -6 Left 998197122 5:140083832-140083854 CCTGCTTTACCAATAAAGTTTTA No data
Right 998197126 5:140083849-140083871 GTTTTATTGGAACCAGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998197126 Original CRISPR GTTTTATTGGAACCAGGATC AGG Intergenic
No off target data available for this crispr