ID: 998199428

View in Genome Browser
Species Human (GRCh38)
Location 5:140107864-140107886
Sequence CAGGGGAAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7407
Summary {0: 1, 1: 9, 2: 137, 3: 1347, 4: 5913}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998199415_998199428 15 Left 998199415 5:140107826-140107848 CCGTCTGCGGCGGCGGCGGCGGC 0: 1
1: 6
2: 118
3: 305
4: 731
Right 998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG 0: 1
1: 9
2: 137
3: 1347
4: 5913
998199410_998199428 25 Left 998199410 5:140107816-140107838 CCACGACTTGCCGTCTGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
Right 998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG 0: 1
1: 9
2: 137
3: 1347
4: 5913

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998199428 Original CRISPR CAGGGGAAGGAGGAGGAGGA GGG Intronic
Too many off-targets to display for this crispr