ID: 998199612

View in Genome Browser
Species Human (GRCh38)
Location 5:140108656-140108678
Sequence GGGGGGAACCGAACAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998199612_998199625 12 Left 998199612 5:140108656-140108678 CCCTCCTCTGTTCGGTTCCCCCC 0: 1
1: 0
2: 0
3: 14
4: 202
Right 998199625 5:140108691-140108713 CCAAATGCATACACCCGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998199612 Original CRISPR GGGGGGAACCGAACAGAGGA GGG (reversed) Intronic
901169546 1:7246635-7246657 GGTGGGAAGGGATCAGAGGAAGG - Intronic
901222541 1:7591693-7591715 GGTGGGAACCAAACAGTGCAGGG - Intronic
903213295 1:21830229-21830251 GGAGGGAACTGAGCAGAGCAAGG + Intronic
904036310 1:27561064-27561086 AGGGGGGACAGATCAGAGGAGGG - Intronic
904477762 1:30775822-30775844 GAGGGGAGCTGAACTGAGGAGGG + Intergenic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
906138991 1:43522109-43522131 AGGGGAAGCCGAACAGAGAAGGG - Intergenic
907029608 1:51157855-51157877 GGGGGGATCCCAGCAGAGGGAGG - Intergenic
907112129 1:51935791-51935813 AAGGGGAAGAGAACAGAGGAAGG + Intronic
907376949 1:54052257-54052279 GGGGGGAAGCATAGAGAGGAGGG + Intronic
907713253 1:56904098-56904120 GGGGTGAAAGGAACAGAGAAAGG - Intronic
907869355 1:58429340-58429362 GGCGGGGACAGAAAAGAGGATGG + Intronic
908922898 1:69217489-69217511 GAGGGGAGGCTAACAGAGGAGGG + Intergenic
909915325 1:81310874-81310896 GGTGAGAAGAGAACAGAGGATGG + Intronic
912451321 1:109769341-109769363 TGGGGAAACCGAAGAGAAGAGGG + Intronic
915952893 1:160201693-160201715 GGAGGGAACAGAACAGAGATGGG - Exonic
917073323 1:171176773-171176795 GGTGGGAACTGAAAAGAAGAAGG - Intergenic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
924048034 1:240052432-240052454 GGTGGAAACAGAAAAGAGGATGG + Intronic
924633475 1:245763575-245763597 GGGTGGAAAGGAAGAGAGGAAGG + Intronic
1065801994 10:29360664-29360686 GGGAGGAACAGAACAGGGCAGGG + Intergenic
1065984403 10:30935487-30935509 TGGTGGAAACGAACAGAGCAAGG + Intronic
1066512587 10:36118225-36118247 GGTGGGAATCAAAAAGAGGAGGG - Intergenic
1068876798 10:62005668-62005690 GGGGAGAACAGAAGAGATGAAGG + Intronic
1069250729 10:66263162-66263184 GGGGGTAACAGAACACAGCAGGG + Intronic
1070399995 10:76045059-76045081 AGGGGGAAACTAACAAAGGAGGG - Intronic
1070992152 10:80741875-80741897 GGAGGGAAACAAACAGAGGAGGG - Intergenic
1072517583 10:96201025-96201047 GGGGGAAACCCAACTGTGGATGG - Exonic
1072917738 10:99549780-99549802 GGGGTGAAGCGAAGAGAGGGAGG - Intergenic
1076076708 10:127539040-127539062 GGGTGGAGCAGAACACAGGAGGG - Intergenic
1076782986 10:132734723-132734745 GGGGAGAACTGAAGAGAGGTGGG - Intronic
1083640586 11:64143146-64143168 GGGAGGAAAGGAAGAGAGGAAGG + Intronic
1085240441 11:75049620-75049642 GGGAGGAACAGAACAGGGCAGGG + Intergenic
1086874834 11:92083106-92083128 GGGGGCAACAACACAGAGGAAGG + Intergenic
1089019966 11:115203339-115203361 AGGGGGTACAGAAAAGAGGAAGG + Intronic
1092242347 12:6843087-6843109 GGGGGGAACCGAGAATGGGAGGG + Intronic
1092546140 12:9452766-9452788 GGGGGGACTAGAACTGAGGAAGG + Intergenic
1092850835 12:12624921-12624943 AGGGGGAACTGAAAAGGGGATGG + Intronic
1092902416 12:13072153-13072175 GGGGGGAACCTGACGGAGGCAGG + Intronic
1093477806 12:19574251-19574273 GGGGGCAACAGGAGAGAGGATGG + Intronic
1098639138 12:72818539-72818561 GAGTGGAACAGAACAGAGAAGGG + Intergenic
1099246975 12:80203684-80203706 GAGGGGAAAGAAACAGAGGATGG - Intergenic
1101595889 12:106163970-106163992 GGGAGGAAGCTACCAGAGGAAGG + Intergenic
1101710166 12:107257468-107257490 GGGGGGACCACAACATAGGATGG - Intergenic
1103711818 12:122918277-122918299 GGGGGGCACCCAAGGGAGGAAGG - Intergenic
1106625726 13:31419188-31419210 GGAGGGAAATGAACAGAGGCAGG + Intergenic
1109193354 13:59351489-59351511 GGCTGGAATCAAACAGAGGATGG - Intergenic
1113799664 13:113079869-113079891 AGGGGCATCCGCACAGAGGAGGG + Intronic
1113799702 13:113080029-113080051 GGGGGCATCCGCACAGAGGAGGG + Intronic
1113799738 13:113080189-113080211 GGGGGCATCCGCACAGAGGAGGG + Intronic
1114811177 14:25901408-25901430 TGGGGGGACAGAAGAGAGGAGGG - Intergenic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1117519887 14:56540871-56540893 AGGCTGAACAGAACAGAGGATGG + Intronic
1117617282 14:57546432-57546454 GGGGGGACCAGAAGGGAGGAGGG + Intergenic
1122961270 14:105094507-105094529 GGGGGGAGCGGCAGAGAGGAGGG + Intergenic
1125591904 15:40859528-40859550 GGTGGGCACAGAGCAGAGGATGG - Intergenic
1125898711 15:43325696-43325718 GGGGGGAAAAGAAGGGAGGAGGG - Exonic
1129077397 15:73008669-73008691 GGGAGGAAGTGGACAGAGGAAGG - Intergenic
1130367707 15:83255030-83255052 GGGGAGAACAGTACAGATGATGG + Intergenic
1132399306 15:101495758-101495780 GGGGGGAAGGGAAGGGAGGAGGG + Intronic
1135898800 16:26435599-26435621 GGGTGGAAAGGAACAGAGGGAGG - Intergenic
1137508991 16:49081669-49081691 GGAGTGAACAGAGCAGAGGAAGG - Intergenic
1138531676 16:57637832-57637854 GAGGGGAGTCCAACAGAGGAAGG - Intronic
1141402717 16:83764590-83764612 GGTGGGAGCCTCACAGAGGAAGG - Intronic
1142153067 16:88521188-88521210 GTGGGAAACAGCACAGAGGAGGG - Intronic
1142153188 16:88521650-88521672 TGGGGGAACAGCACAGGGGAGGG - Intronic
1142153228 16:88521793-88521815 GGAGGGAACAGCACAGGGGAGGG - Intronic
1142153233 16:88521810-88521832 GGAGGGAACAGCACAGGGGAGGG - Intronic
1142957457 17:3531488-3531510 GGAGGACACGGAACAGAGGAGGG + Intronic
1143253505 17:5539349-5539371 GGGGGGTATCGGACAGGGGATGG - Intronic
1144369435 17:14575943-14575965 GGAGGGAGCCGAACAGAGCCTGG - Intergenic
1144835344 17:18153947-18153969 GGGCTGAAGCGAGCAGAGGAGGG + Intronic
1147490697 17:40863380-40863402 GGAGGGGACCGAAAAGAGGAGGG + Intronic
1148745674 17:49916666-49916688 GGGGGGACCCCCACACAGGATGG + Intergenic
1148770680 17:50064251-50064273 GGGGGGTACCGCAGAGAGAATGG + Intronic
1148894819 17:50833522-50833544 GGGAGGCACCGAGCAGAGGTTGG - Intergenic
1151175519 17:72284681-72284703 GGAGGGAAGCGAAGAGAAGACGG + Intergenic
1151382373 17:73734743-73734765 GGTGGGAACAGAGCAGAGGGAGG - Intergenic
1154068435 18:11130874-11130896 GTGGGGTACAGAACAGGGGAAGG + Intronic
1155448060 18:25933657-25933679 GGGGGGAAATGAAGAGAGGTTGG - Intergenic
1157038418 18:44006609-44006631 GAGGGAAACAGAAGAGAGGAAGG + Intergenic
1158429241 18:57369366-57369388 GGGGTGAAAGGTACAGAGGAAGG - Intronic
1158491734 18:57916298-57916320 GGGAGGAAGTGACCAGAGGAGGG + Intergenic
1159650022 18:70967304-70967326 GGGAGGAACTGAACTGAGAAAGG - Intergenic
1160105475 18:75970511-75970533 GGAGGGAACCGTACAGAGGGAGG - Intergenic
1161288405 19:3480197-3480219 GGGGGGTCCCTTACAGAGGAGGG + Intronic
1162126155 19:8500436-8500458 GGGGGGAACTGACCAGGGAAGGG - Intronic
1162396918 19:10422667-10422689 GGGGTGATCAGAACAGAGGTGGG - Intronic
1163067833 19:14812463-14812485 GAGTGGAACAGAACAGAGCAGGG - Intronic
1163907721 19:20161659-20161681 GGGAGGAACAGAACAGGGCAGGG - Intergenic
1165081508 19:33309793-33309815 GCGGGGAATGGAATAGAGGATGG - Intergenic
1165776689 19:38408817-38408839 TGGAGGAGCCGAAGAGAGGATGG + Exonic
1166219253 19:41354255-41354277 CAGGGGAGCCGACCAGAGGAGGG + Intronic
1166349503 19:42188890-42188912 GGGAGGAAGAGAAGAGAGGAAGG + Intronic
1166535416 19:43571073-43571095 GGAGGGCTCCGAGCAGAGGAGGG - Intronic
1166892308 19:46000946-46000968 GGAGGAGACCGCACAGAGGAAGG - Intronic
1167435259 19:49475219-49475241 GGGGGGAGATGGACAGAGGAGGG + Intronic
1167573431 19:50305169-50305191 GGTGGGAATGGATCAGAGGAGGG + Intronic
1168607061 19:57768636-57768658 GGGAGGAACAGAACAGGGCAGGG + Intergenic
926396374 2:12446836-12446858 GGAAGGAACAGAACAGAAGAAGG + Intergenic
927713405 2:25339487-25339509 GGGAGGAGCTGCACAGAGGAGGG + Intronic
928413160 2:31070012-31070034 GGGGGTAAGCGGACACAGGAAGG - Intronic
929459517 2:42092144-42092166 GAGGGGAACCTAACAGAGTTGGG - Intergenic
935698571 2:105790677-105790699 GGGGTGCCCAGAACAGAGGAAGG - Intronic
936104903 2:109615068-109615090 GGGGGCTACCGCACAGAGGCCGG + Exonic
938196652 2:129334528-129334550 GGGGTGAAACGGACAGTGGAGGG - Intergenic
938755737 2:134377395-134377417 GGGGGGAAAGAATCAGAGGAAGG - Intronic
939754255 2:146090082-146090104 GGGAGGAAGAGAACAAAGGAGGG - Intergenic
941021111 2:160408160-160408182 GGGGGAAAAAGAACAGAGGAGGG - Intronic
942608328 2:177714979-177715001 GTGGGGAACCAGACACAGGAGGG - Intronic
942925493 2:181426997-181427019 GGAGGGAAAGGAAGAGAGGAGGG - Intergenic
945188809 2:207166121-207166143 GCGGAGAACCGAACGGAGGGAGG - Intronic
945369759 2:209002916-209002938 GGTGGGGACCAATCAGAGGAAGG - Intergenic
946420694 2:219562967-219562989 GGGTGGAACTGATGAGAGGAGGG + Intronic
948430121 2:237913521-237913543 GGGGGGAACAGAGGAGAGAAGGG - Intergenic
948559200 2:238839474-238839496 GGAGGGAGCGGAGCAGAGGAGGG + Intergenic
948789820 2:240371461-240371483 TGAGGGAACCAGACAGAGGATGG + Intergenic
1172466514 20:35159251-35159273 GGGGAAAACTTAACAGAGGATGG + Intergenic
1172949858 20:38715943-38715965 TGGGGGAGCCAAACTGAGGACGG + Intergenic
1173954063 20:47017139-47017161 GGGGGCACCAGAACAGAGAAGGG - Intronic
1175487384 20:59355720-59355742 GGGGGGAGAGGGACAGAGGAGGG - Intergenic
1177375952 21:20271117-20271139 GGGAGGAACAGAACAGGGCAGGG - Intergenic
1178759591 21:35388986-35389008 GGGGGAAACAGACCAGAGGCTGG - Intronic
1182008846 22:26983648-26983670 GAGGGGAACTGAACAGAGAAGGG - Intergenic
1182039026 22:27221938-27221960 GGGGTGAACCGCACACAGGTAGG + Intergenic
1183179544 22:36250467-36250489 GGGGGGAACAGAACAGGGCAGGG - Intergenic
1184257629 22:43296188-43296210 GTGGGGACCCGAACAGAGCTGGG - Intronic
950620966 3:14204946-14204968 GGGGGCAACTGACCAGAGGCAGG - Intergenic
950707101 3:14789658-14789680 GGAGGGGGCCGAACAGAAGAGGG + Intergenic
952829882 3:37555812-37555834 GGGGGAAACAGAACAGAAGAAGG + Intronic
953582115 3:44166817-44166839 TGGGAAAACCAAACAGAGGAGGG - Intergenic
954386647 3:50247599-50247621 GGAGGGAACCGATGAGAGAAGGG - Intronic
955042623 3:55332335-55332357 GGAGGGGACAGAACAGAGCAGGG + Intergenic
955169144 3:56546255-56546277 GGGTGGACCCGAAGAGAAGATGG + Intergenic
955235671 3:57136977-57136999 AGGGGTAATTGAACAGAGGAAGG + Intronic
955759406 3:62262418-62262440 TGGGAGCACAGAACAGAGGAAGG - Intronic
956871223 3:73420247-73420269 AAGGGGAACAAAACAGAGGATGG - Intronic
958960617 3:100506094-100506116 GGGGGGAAGAGAACAGAGCCTGG + Intronic
960256079 3:115512776-115512798 GAAGGGAACAGAAGAGAGGATGG + Intergenic
963328147 3:143884706-143884728 GAGGGGAACTGAAGAGGGGACGG + Intergenic
964477415 3:157109582-157109604 GGGGGGAAAAGAACAGTGCATGG - Intergenic
968938679 4:3626686-3626708 GGCGGCAACCGAGGAGAGGAGGG - Intergenic
968941187 4:3639527-3639549 GGGGTGAACAGATCAAAGGAAGG + Intergenic
969253993 4:5990356-5990378 GGGGAGAACTGAAGAGGGGAAGG - Intergenic
969874171 4:10123732-10123754 GGGGGGAATCGCACTGCGGATGG + Intergenic
970203881 4:13636333-13636355 GGGTGGAAACTAACACAGGAAGG + Intergenic
971011988 4:22448465-22448487 GGGTGGAACACAGCAGAGGATGG + Intronic
973345340 4:49048809-49048831 GGGGGGAACACAAAATAGGAAGG + Intronic
976789555 4:88862724-88862746 GGGGGCATCAGAACAGAAGAAGG - Intronic
977018129 4:91720255-91720277 GGGGGGAACTGTACAAAGAAAGG + Intergenic
978741726 4:112145355-112145377 GGGCGGAGCCGTACAGGGGAGGG - Intergenic
978928461 4:114280345-114280367 GGGGGGAACTGAATGGGGGATGG + Intergenic
980987613 4:139710955-139710977 GGGGGTAACAGGACAGAGAAGGG + Intronic
981136904 4:141220837-141220859 GGGGCGGAGCGAACAGAGGTGGG + Intergenic
982721512 4:158864816-158864838 GGGGTGAAGCCAAAAGAGGATGG - Intronic
985488816 5:167023-167045 GGGGGCAGCAGAACACAGGAAGG + Intronic
986009977 5:3704967-3704989 GAGGGCAACAGAACAGATGAGGG - Intergenic
986690285 5:10308032-10308054 GGAGGGAACCGCAGAGAGGAAGG + Intergenic
987210896 5:15682111-15682133 GTGGGGGACAGAAGAGAGGAGGG + Intronic
989775856 5:45206350-45206372 GAGTGGAACAGAACAGAGCAGGG - Intergenic
990935832 5:61148176-61148198 GGGGGAACCCAACCAGAGGATGG - Intronic
995284264 5:110368782-110368804 AGGGGGAGCCAAACAGGGGATGG + Intronic
998199612 5:140108656-140108678 GGGGGGAACCGAACAGAGGAGGG - Intronic
1002673621 5:180890478-180890500 GGGACGAACCTTACAGAGGAAGG + Intergenic
1002677251 5:180927103-180927125 GGGACGAACCTTACAGAGGAAGG + Intronic
1002682223 5:180975539-180975561 TGGGGGAACCCCATAGAGGAAGG + Intergenic
1002709422 5:181185676-181185698 GGAGGGGACCGAACAGAGCCTGG + Intergenic
1004321933 6:14638735-14638757 GTGGGGAGCAGAAAAGAGGAAGG - Intergenic
1004544997 6:16589056-16589078 GGGGGGAACAGAAGAGAGAAGGG - Intronic
1004989316 6:21119117-21119139 GGGAGGAAAGGAGCAGAGGAGGG - Intronic
1008228931 6:48959731-48959753 GAGGGGAACAGAGGAGAGGAGGG - Intergenic
1009856739 6:69274570-69274592 GGGAGGAAACGAATAAAGGAAGG - Intronic
1012585332 6:100914541-100914563 GAGGGGAACAGAACAGGGAAGGG - Intergenic
1013580654 6:111531011-111531033 GTGGGGCACTGAACAGAAGAGGG - Intergenic
1013635575 6:112026345-112026367 GGGGGCAACAGAACAGAGCTAGG - Intergenic
1014684384 6:124477745-124477767 GGGGGGAAAGGAAAAGGGGAAGG - Intronic
1016309631 6:142719791-142719813 AGGGGGAACCCAACAGAGTCTGG - Intergenic
1019906884 7:4071559-4071581 AGGGGGAACTGAGCAGGGGAGGG + Intronic
1023616301 7:42023624-42023646 GGGGGGCAGGGAACAGAGAAGGG + Intronic
1024228708 7:47347714-47347736 GCTGGGAACCGAAGAGAGGATGG - Intronic
1024696318 7:51860045-51860067 GGATTGAACCGAGCAGAGGAAGG + Intergenic
1025852020 7:65251728-65251750 GGGGGGAACAGAACAGGCAAAGG - Intergenic
1026846251 7:73700573-73700595 GGGGGGATCCAAGCAGGGGAAGG + Intronic
1029452627 7:100649754-100649776 GGCTGGAACTGGACAGAGGAGGG - Intronic
1031742693 7:125454869-125454891 GGGAGGAACAGAACAGGGCAGGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034391614 7:150791821-150791843 GGGGAGATCAGAGCAGAGGAGGG + Intronic
1034653852 7:152713020-152713042 GGGAGGAAGAGAAGAGAGGAAGG - Intergenic
1034748672 7:153547670-153547692 GAGGGGGACAGAAGAGAGGATGG - Intergenic
1035025503 7:155822356-155822378 GGTGGGAAAGGCACAGAGGAGGG - Intergenic
1036089014 8:5644903-5644925 GGAGAGAACAGGACAGAGGAGGG - Intergenic
1038989857 8:32856350-32856372 AAGGGGAACGGAAGAGAGGAGGG - Intergenic
1039396406 8:37228755-37228777 GGGGGGAATAGAACAGTGGATGG + Intergenic
1039420009 8:37429689-37429711 GGTGGGAACTGAAAAGAAGAAGG + Intergenic
1041510774 8:58652670-58652692 GGGGGGTACCTCACAGAGAAAGG - Intronic
1042595169 8:70439669-70439691 GGGTGGAACAGAGCTGAGGAAGG + Intergenic
1045054310 8:98356192-98356214 GGGGGACCCAGAACAGAGGAAGG - Intergenic
1045674235 8:104589595-104589617 TGGGGGTACCGGATAGAGGAAGG - Intergenic
1048236251 8:132693660-132693682 GGGGGAAAGCAAGCAGAGGAAGG + Intronic
1053288612 9:36865520-36865542 GGGAGGAAGGGAAGAGAGGAGGG + Intronic
1055506822 9:76956539-76956561 GGGAGGAACAGAACAGCGCAGGG - Intergenic
1057138976 9:92715494-92715516 GGGCAGAGCCGAGCAGAGGAGGG + Intronic
1057431731 9:95001072-95001094 AGGGGGCACAGGACAGAGGAAGG - Intronic
1057672783 9:97109377-97109399 GGCAGGAGCAGAACAGAGGAAGG - Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1059061921 9:111042010-111042032 AGAGGGAAGCGAACAGAGGGAGG - Intergenic
1061819555 9:133218730-133218752 GAGAGGAACCCAACAGAGCAAGG + Intergenic
1062241130 9:135539463-135539485 GAGAGGAACCCAACAGAGCAAGG - Intergenic
1062444963 9:136589786-136589808 GGGGGGCACCGCACTGTGGAGGG - Intergenic
1062552421 9:137095703-137095725 GTGGGGAAGGGAGCAGAGGACGG + Intronic
1186011484 X:5138986-5139008 GGGGGGAACAGAGGAGTGGAGGG + Intergenic
1186452085 X:9682489-9682511 GGTGGGGACAGAACAGAGGGTGG + Intronic
1186963389 X:14761443-14761465 GGGGGGTAGAGAAAAGAGGATGG + Intergenic
1188897928 X:35693522-35693544 GGGAGGAACAGAACAGGGCAGGG - Intergenic
1192265940 X:69538326-69538348 GGGTGGAACAGGACAGTGGAGGG - Intergenic
1192275795 X:69629707-69629729 GGAGGGAAAGGAACTGAGGAAGG - Intronic
1193486087 X:82086746-82086768 GAGGGGAGCTGAAGAGAGGATGG + Intergenic