ID: 998200149

View in Genome Browser
Species Human (GRCh38)
Location 5:140113016-140113038
Sequence CAGAAGGAGGAGGGGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3788
Summary {0: 1, 1: 0, 2: 22, 3: 514, 4: 3251}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998200132_998200149 8 Left 998200132 5:140112985-140113007 CCTGAGCAGGGTGCCCCCCTTCC 0: 1
1: 0
2: 4
3: 26
4: 265
Right 998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG 0: 1
1: 0
2: 22
3: 514
4: 3251
998200133_998200149 -5 Left 998200133 5:140112998-140113020 CCCCCCTTCCCCAAATCTCAGAA 0: 1
1: 0
2: 5
3: 85
4: 484
Right 998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG 0: 1
1: 0
2: 22
3: 514
4: 3251
998200138_998200149 -9 Left 998200138 5:140113002-140113024 CCTTCCCCAAATCTCAGAAGGAG 0: 1
1: 0
2: 0
3: 23
4: 295
Right 998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG 0: 1
1: 0
2: 22
3: 514
4: 3251
998200134_998200149 -6 Left 998200134 5:140112999-140113021 CCCCCTTCCCCAAATCTCAGAAG 0: 1
1: 0
2: 2
3: 43
4: 391
Right 998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG 0: 1
1: 0
2: 22
3: 514
4: 3251
998200137_998200149 -8 Left 998200137 5:140113001-140113023 CCCTTCCCCAAATCTCAGAAGGA 0: 1
1: 0
2: 3
3: 32
4: 353
Right 998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG 0: 1
1: 0
2: 22
3: 514
4: 3251
998200131_998200149 9 Left 998200131 5:140112984-140113006 CCCTGAGCAGGGTGCCCCCCTTC 0: 1
1: 0
2: 5
3: 10
4: 239
Right 998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG 0: 1
1: 0
2: 22
3: 514
4: 3251
998200135_998200149 -7 Left 998200135 5:140113000-140113022 CCCCTTCCCCAAATCTCAGAAGG 0: 1
1: 0
2: 0
3: 36
4: 320
Right 998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG 0: 1
1: 0
2: 22
3: 514
4: 3251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998200149 Original CRISPR CAGAAGGAGGAGGGGGAGGC GGG Intronic
Too many off-targets to display for this crispr