ID: 998200907

View in Genome Browser
Species Human (GRCh38)
Location 5:140119482-140119504
Sequence CTGAATTAAATTTGGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998200907 Original CRISPR CTGAATTAAATTTGGGTGGA AGG Exonic
901240924 1:7692784-7692806 CTGAATGACAGGTGGGTGGACGG - Intronic
903800085 1:25960627-25960649 CTGACTTAAATTTGGGGCAAGGG + Exonic
908880035 1:68721275-68721297 CTAAATTAAATGTTGCTGGAGGG + Intergenic
909201544 1:72695372-72695394 CTGAATTATAATTGGTTGAAAGG + Intergenic
910165876 1:84326845-84326867 CTGAAGTAAATATAGGTTGAAGG - Intronic
911469154 1:98295091-98295113 GAGTATTAATTTTGGGTGGATGG + Intergenic
911638937 1:100266620-100266642 CTGAGGTAAATCTGGCTGGAGGG + Exonic
911961863 1:104314760-104314782 GTGAATTAAATTTTGGTTGACGG - Intergenic
914946305 1:152069731-152069753 CTGCAGTAAACGTGGGTGGAGGG - Intergenic
919275667 1:195412891-195412913 TAGAATTAAACTTGGGTGGAAGG - Intergenic
919322098 1:196056523-196056545 CTAAATTAAATATGGCTAGAGGG + Intergenic
921203080 1:212825304-212825326 CTGAATTCCACTGGGGTGGATGG - Intergenic
921627809 1:217397508-217397530 CTGAATTGAATATGGGGGGGTGG - Intergenic
923079653 1:230641669-230641691 CAGAATAAAATTGGGGTGGGTGG + Intergenic
923329888 1:232913246-232913268 CCATATTTAATTTGGGTGGAGGG - Intergenic
1063726381 10:8641960-8641982 CTGAATGAAATTTGTGGGGAAGG + Intergenic
1065133204 10:22643473-22643495 CTGAATTAAACAGGGATGGAAGG - Intronic
1066028054 10:31384960-31384982 TTGAACTAACTTTGGGGGGAAGG - Intronic
1067104979 10:43360638-43360660 CTGAGTAATATTTGGGTGGATGG - Intergenic
1068943927 10:62709195-62709217 CTGAATTAAAATTGGAAGCAAGG - Intergenic
1069187561 10:65444538-65444560 CTGAATGAAATTAGGGAGGTGGG - Intergenic
1070417480 10:76204262-76204284 ATGAAATAAAGATGGGTGGATGG - Intronic
1071950109 10:90693573-90693595 CTGATTTAAAGATGGGTGAAAGG - Intergenic
1072093483 10:92152918-92152940 ATGAGTAAAATTTGGGTGGAAGG + Intronic
1073537977 10:104295198-104295220 ATGAATAAAATTTGGTTAGAGGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1077974660 11:7235186-7235208 ATGAATTAAACTTGGGTGGGGGG + Intergenic
1080018306 11:27531230-27531252 CTGAATTGAATTTGAGTGCTGGG + Intergenic
1082985460 11:59166219-59166241 CTGAGTTAAATTTTTGTGTATGG - Intergenic
1083254299 11:61486798-61486820 CTGAAATAGAATTGGCTGGAAGG + Intronic
1084596212 11:70118478-70118500 ATGAATGACAGTTGGGTGGATGG + Intronic
1085235935 11:75015523-75015545 CCGAATTAAATTCTTGTGGAGGG - Intronic
1085857698 11:80194399-80194421 GTGAAATAAAGTGGGGTGGAGGG + Intergenic
1086363007 11:86078626-86078648 GTGACTTAAATTAGGGTGGTAGG + Intergenic
1088782400 11:113148731-113148753 CTGCAGTAGTTTTGGGTGGAGGG + Intronic
1091248573 11:134121852-134121874 CTGAATTTTGTTTGGGAGGAGGG - Intronic
1093777539 12:23094243-23094265 CTGAAATTAATTTTGGTGTATGG + Intergenic
1093978315 12:25448530-25448552 CTGAATCCATTTCGGGTGGAAGG - Intronic
1095365068 12:41393731-41393753 CTTAATGATATTTGGTTGGAAGG + Intronic
1097368799 12:58749753-58749775 GAGAATGAAATTTGGGTTGAAGG - Intronic
1097965341 12:65573155-65573177 ATGAATTATATATGGTTGGATGG + Intergenic
1097990831 12:65831422-65831444 TTGAATTAAATTTTATTGGAAGG + Intronic
1098084416 12:66826777-66826799 CTGAATTAAAATTGGAGTGAAGG + Intergenic
1098206055 12:68110914-68110936 CTGTAATAAATTGGGGTGGGTGG + Intergenic
1098846874 12:75547910-75547932 CTGCACTAAATTTACGTGGAAGG + Intergenic
1099938602 12:89158339-89158361 CTGAATGAAATTTGGGTTTCAGG - Intergenic
1100915579 12:99417048-99417070 CTCATTTATATTTGGGAGGAAGG + Intronic
1102927264 12:116835854-116835876 CTGAGTCAAAAATGGGTGGAGGG + Intronic
1106264635 13:28099655-28099677 CTGAATCGAATTTGGGTTGAAGG - Intronic
1108041863 13:46346704-46346726 TTTAATTAAATTTTGGGGGAAGG - Intronic
1111378652 13:87415550-87415572 AAGAATTAAATTTTGGTGGAAGG - Intergenic
1111385693 13:87523781-87523803 TTAATTTAAATTTGTGTGGAAGG - Intergenic
1112266186 13:97925862-97925884 CTGAAACAAAGTTGGGTGGGGGG - Intergenic
1113097544 13:106681571-106681593 TTGAAATAAAATTGGGTGGATGG + Intergenic
1113874609 13:113586151-113586173 CTTAATTAAATTGAGGTGGAGGG + Intronic
1114742885 14:25116228-25116250 CTGAATTATAATTGGTTGAAAGG + Intergenic
1115379125 14:32713735-32713757 CTGAATTAGGTTTGGCTTGAGGG + Intronic
1116746840 14:48830884-48830906 ATGAATTAAATGTGAGTGGTGGG + Intergenic
1118506015 14:66412696-66412718 TTTAATGGAATTTGGGTGGAAGG + Intergenic
1118749333 14:68795062-68795084 ATGATTTAAATTAAGGTGGATGG - Intronic
1119816447 14:77572886-77572908 CTGGATTAGATTTGGGTTTAAGG + Intronic
1123976765 15:25561142-25561164 CTAAATTAAAAGTGGGGGGAGGG - Intergenic
1126366510 15:47900028-47900050 CTGAATTAAATCAGAGTGAATGG + Intergenic
1126555753 15:49985751-49985773 CTGAATTAAATTTGAAAGAAGGG + Intronic
1126584818 15:50273715-50273737 ATGTATTAAATTTGGGTGGTAGG + Intergenic
1126909168 15:53400006-53400028 ATGAACTAAATTTGGGATGAAGG + Intergenic
1129105954 15:73307406-73307428 CTGAAATAATTAGGGGTGGAGGG + Intergenic
1133919531 16:10139676-10139698 CTGAATCAAAGTGGGGTGGGGGG + Intronic
1134116672 16:11553909-11553931 CTGAATCATATTCTGGTGGATGG - Intronic
1136384285 16:29913225-29913247 CTGACCTAAGTTTGGGAGGATGG - Intronic
1140194766 16:72847116-72847138 CTGAAATACATTTAGGTGCAGGG - Intronic
1141269072 16:82522528-82522550 CTGAAGTAAATGGTGGTGGAGGG + Intergenic
1144315270 17:14054666-14054688 CTGAAATAAATTTTGGAGTAGGG + Intergenic
1144317869 17:14080984-14081006 CTGGATTATATTTCAGTGGAAGG + Intronic
1145222007 17:21097181-21097203 TTGAAATACATTTGGGTGGTGGG - Intergenic
1147786192 17:42980432-42980454 CTGAATTAAATTCCCGGGGAAGG + Exonic
1149949572 17:60971469-60971491 CTGAATTAAAGCTGGGGTGATGG + Intronic
1150987176 17:70212094-70212116 CTGGAATAAATGTGGGTGGTGGG - Intergenic
1155220225 18:23678433-23678455 CTGAAGTGAATTTGGGAGAATGG + Intergenic
1158344122 18:56497715-56497737 ATGAATTAAGTTTGGATGGATGG + Intergenic
1158831683 18:61286544-61286566 CTAAATTAAATTGGAGAGGATGG + Intergenic
1159117170 18:64127928-64127950 CTGAGCTAATTTTGGGAGGAGGG + Intergenic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1162569502 19:11463068-11463090 ATGAATCAGATTTGGGTTGAGGG + Intronic
1163260537 19:16187041-16187063 CTGAATTAGATCTGGGAGTAAGG - Intronic
1164881499 19:31735956-31735978 ATGAATTAAATTAAGTTGGATGG - Intergenic
1166587521 19:43963320-43963342 CAGAATTAATTTTGGGGGGAAGG - Intronic
1166669060 19:44698871-44698893 CTACTTTAAATTGGGGTGGAGGG - Intergenic
1167851390 19:52205139-52205161 CTGCATTTAAGTTGGGTGTATGG - Intronic
1167874192 19:52398008-52398030 CTGAATTTACTCGGGGTGGAGGG - Intronic
926103012 2:10132632-10132654 CTGAAGTATTTTGGGGTGGATGG + Intergenic
927019886 2:19005598-19005620 CAGACTTAAATTTGAGTGGTTGG - Intergenic
929813765 2:45214256-45214278 TTGAACTAGATTTGGGTGGGTGG - Intergenic
930559068 2:52937557-52937579 CTGAATTAACATAGGGTTGAAGG - Intergenic
931711774 2:64993974-64993996 CTGAAATAAATGAGGGTAGATGG + Intronic
935600524 2:104917529-104917551 TTGAATGAAATTTGGGGGGATGG + Intergenic
936946830 2:117938692-117938714 CTGAATGAAATGGGGGTGGTGGG - Intronic
938599774 2:132825301-132825323 ATGCATTAAATTTTTGTGGATGG - Intronic
939102837 2:137915216-137915238 CTGAATAGGATCTGGGTGGATGG + Intergenic
939129169 2:138213633-138213655 CTCAATTAAATTCAGGTGAATGG + Intergenic
940022543 2:149170498-149170520 CTGGATTAAATTTGGATGTATGG + Intronic
941198338 2:162477864-162477886 CTCAATAAAAGTTGGGTGGGTGG - Intronic
943771802 2:191725653-191725675 CTGAATTAACTCTGTGTGTAAGG - Intergenic
946388850 2:219403384-219403406 CTAAATAAAATTTGGGAGTAAGG + Intergenic
1170868884 20:20186581-20186603 CTGAACTAGATTTTGGTGTAAGG + Intronic
1172933127 20:38600365-38600387 CTTAATAAAGGTTGGGTGGATGG - Intergenic
1173863904 20:46302096-46302118 CTGAATTAAATTTGGGTGTGAGG - Intronic
1175012704 20:55755943-55755965 CTTTATTCAATTTAGGTGGAGGG - Intergenic
1175889260 20:62309127-62309149 CACAATTAAAAATGGGTGGAAGG + Exonic
1176285820 21:5018967-5018989 CGGGATTAAATTGAGGTGGAAGG + Intergenic
1176990256 21:15487384-15487406 CTAAATTAAATTATGTTGGAGGG + Intergenic
1179675878 21:42981805-42981827 CTGACTTCAAGTTGGGTGGGTGG + Intronic
1179871361 21:44244508-44244530 CGGGATTAAATTGAGGTGGAAGG - Intergenic
1181498713 22:23303029-23303051 GTGAATTAAATTGGGGTGGGGGG - Intronic
1182311015 22:29406620-29406642 CTGAATTAGATTTGGGTTCTAGG - Intronic
1182690092 22:32154479-32154501 CTGAATTAGATTTGGGTTCTTGG + Intronic
1183577802 22:38702878-38702900 TTGAATTAAATTTTTGTGGCCGG + Intergenic
949499614 3:4667156-4667178 CTTAATTACATTTGTGTGGCAGG + Intronic
950414185 3:12859051-12859073 CTGAATTATATTTGGGCGGTTGG - Intronic
952528024 3:34233264-34233286 CTGAAATATATTTTGGTGTAAGG + Intergenic
955623690 3:60893792-60893814 TTGACTTTAATTTGGTTGGAAGG - Intronic
955623992 3:60896665-60896687 TTGACTTCAATTTGGTTGGAAGG - Intronic
956027304 3:64996940-64996962 CTGAATTAATCTTGTGTGGAGGG - Intergenic
956248621 3:67212449-67212471 CTGAAATAAATTGGATTGGATGG - Intergenic
956961286 3:74404258-74404280 CTTAATTCAATTTGGTTGAAAGG + Intronic
957143297 3:76388589-76388611 ATGAATGAAATTTGGCTGTAGGG - Intronic
958445440 3:94209400-94209422 GAGAATTAAATTTGGGATGAGGG + Intergenic
959790563 3:110356463-110356485 ATGAATTAACTTTGGGTTAAAGG - Intergenic
960110445 3:113839913-113839935 CTGAATCAAATTTGGGATGGGGG - Intronic
963554022 3:146762782-146762804 ATGAATTAAAGTTAAGTGGAAGG - Intergenic
964035326 3:152188753-152188775 CTGGATTAGATTTGGGTTTAAGG - Intergenic
967790616 3:193545113-193545135 AAGAATTAAGTTTGGGTAGATGG - Intronic
967862137 3:194160275-194160297 CTCAAGTACATTTGGGTGCATGG + Intergenic
969037089 4:4263146-4263168 CTGAATTACATGTGGGCGGGAGG - Intergenic
970148916 4:13068600-13068622 TTGGATTAAATTTCGGTGGAAGG + Intergenic
970966139 4:21930312-21930334 CTGAATTAAAGCAGTGTGGAAGG - Intronic
971498942 4:27298191-27298213 ATTAAATAAGTTTGGGTGGAGGG - Intergenic
971767841 4:30856125-30856147 ATGAACTAAATTTAGGTGTAAGG - Intronic
972109350 4:35537348-35537370 CTGAATTAAAGTGAGGAGGAAGG - Intergenic
972801698 4:42482486-42482508 CTGAATAAATTTGGGGTGGGGGG + Intronic
975078801 4:70249266-70249288 CTGAATTTTCTTTGGGGGGATGG - Exonic
976130256 4:81876665-81876687 ATGAATTAAATGTTGGTAGAAGG - Intronic
977341054 4:95758635-95758657 CTGAATTAAAGTGGGGTACACGG - Intergenic
978141176 4:105318902-105318924 ATCAATTAAATGTAGGTGGAAGG - Intergenic
980592219 4:134905010-134905032 CCAAATCAAATTTGGGTTGATGG - Intergenic
981807761 4:148736492-148736514 CAGAATTAAGTTTTGGTGGTAGG - Intergenic
984399843 4:179248285-179248307 CTGAATTCTATTTGGATGGCAGG - Intergenic
985850895 5:2388400-2388422 CTGAATGAATTGGGGGTGGAGGG - Intergenic
985905075 5:2828244-2828266 ATGAAATAATTTTGGATGGAGGG - Intergenic
986769065 5:10955547-10955569 CTGAACTAAATTTGGGGTAAGGG - Intergenic
986887646 5:12259504-12259526 TTAAATTAAATTTGAGTTGATGG + Intergenic
987372820 5:17208771-17208793 GTGAAAGAAATCTGGGTGGAGGG + Intronic
987567836 5:19616312-19616334 GTGCATAAAATTTGGGTGGGGGG - Intronic
992057863 5:73010164-73010186 GAGAATCAAATTTGGGTGGTAGG + Intronic
995107435 5:108390400-108390422 ATGAGTAAAATTTGGGTGTAAGG + Intergenic
995131171 5:108631891-108631913 CTGAATGAAAATTAGGTAGAAGG + Intergenic
997711702 5:136009841-136009863 TTGAAATTAATTAGGGTGGATGG - Intergenic
998200907 5:140119482-140119504 CTGAATTAAATTTGGGTGGAAGG + Exonic
998582603 5:143394922-143394944 ATGAATTAATTGGGGGTGGAGGG - Intronic
999479776 5:151937104-151937126 CTTAATTAATTTTGGGGGGTTGG + Intergenic
1000512750 5:162204139-162204161 CTGAATAAAATTTGGAGAGAAGG + Intergenic
1003818100 6:9864084-9864106 CTGAAGTAAATCTGGGTGGCAGG + Intronic
1004369247 6:15037968-15037990 CTGAAGTGAATTTGTGTGGAGGG - Intergenic
1005164895 6:22908528-22908550 CAGAATTGACTATGGGTGGAGGG + Intergenic
1005679966 6:28197033-28197055 CTTCATTATTTTTGGGTGGAGGG + Intergenic
1006150353 6:31983706-31983728 CTGAAGGAAATAAGGGTGGAAGG + Intronic
1006156654 6:32016444-32016466 CTGAAGGAAATAAGGGTGGAAGG + Intronic
1008549392 6:52613115-52613137 CTTAATTAAAATTGTATGGAGGG + Intergenic
1010033554 6:71294528-71294550 CTGGATTGAGTTTGGGAGGAGGG + Intronic
1013226120 6:108120206-108120228 CTGAAGTAAATAGGGGTGGGGGG + Intronic
1013565228 6:111352366-111352388 CTGATGGAAATTGGGGTGGAAGG + Intronic
1013576224 6:111485230-111485252 CTGAATTATATTTTGGGGGATGG + Intergenic
1014293488 6:119588724-119588746 ATAAATTTGATTTGGGTGGAAGG - Intergenic
1014999214 6:128193497-128193519 CTGAATTAAATTTTTGTTCAAGG - Intronic
1015126659 6:129762794-129762816 AGCAATTAAGTTTGGGTGGAGGG + Intergenic
1016441683 6:144090637-144090659 CTCAATTAAATTTATTTGGACGG + Intergenic
1016640181 6:146339272-146339294 GTGAATTGAGTTTGGGTGGAAGG - Intronic
1020410968 7:7891048-7891070 CTCAATAAAATCTGGATGGATGG + Intronic
1022598391 7:31734077-31734099 CTGAATCAAGTTTTGGTGGTGGG - Intergenic
1022806519 7:33828177-33828199 TTGAATTAAATGGGGGAGGAGGG - Intergenic
1024164390 7:46715593-46715615 CTGAATAAAATTTATTTGGAAGG - Intronic
1025173844 7:56786243-56786265 TTCAACTAACTTTGGGTGGAAGG + Intergenic
1025829989 7:65040170-65040192 TTCAACTAACTTTGGGTGGAAGG - Intergenic
1027770742 7:82403015-82403037 GCCAACTAAATTTGGGTGGAAGG + Intronic
1028628150 7:92900875-92900897 CTGATTTAATTTTGGCTGAAGGG - Intergenic
1028796764 7:94911153-94911175 CTGAAGCTAATTTGGTTGGAAGG + Exonic
1029502796 7:100944073-100944095 GCCAATAAAATTTGGGTGGAAGG + Intergenic
1029834992 7:103299871-103299893 CAGAAGTAAATGTGGGAGGATGG - Intronic
1030673146 7:112359203-112359225 TAGAATTAGATTTGGGAGGAAGG - Intergenic
1031627216 7:124004961-124004983 CTGAGTTAACCTGGGGTGGAAGG - Intergenic
1031999517 7:128255648-128255670 CTGAATAACATTTGTGTGGTGGG + Exonic
1033866017 7:145691471-145691493 CTTACTAAAATTTGGGTGCATGG - Intergenic
1036068469 8:5411743-5411765 CTGAACTAAACTGGCGTGGATGG - Intergenic
1037211831 8:16398404-16398426 AAGAATGACATTTGGGTGGATGG - Intronic
1037868093 8:22464171-22464193 CTTTATTAAATTTGGGTTAAAGG - Intronic
1039188624 8:34946444-34946466 CTCAATTATATGTGGGTGGGAGG + Intergenic
1039197322 8:35047181-35047203 CTGAATGAAATGTGGGGGCAGGG + Intergenic
1040416111 8:47197477-47197499 CAGAAATAAACTTGGCTGGAGGG - Intergenic
1041243951 8:55873442-55873464 CTGAATTTAGTTTGGGGTGACGG + Intergenic
1042691214 8:71501168-71501190 GTATATTAAATTTGGGTGGTGGG + Intronic
1043863858 8:85353296-85353318 CTTAATTTAATTTTGTTGGACGG + Intronic
1044522686 8:93217701-93217723 GTTAATTAACTTTGGGAGGATGG - Intergenic
1045035839 8:98176011-98176033 CAGAATCAATTTTGGGTGGGAGG + Intergenic
1047132870 8:122040635-122040657 CTGGAATAAATTTTGGTGTATGG + Intergenic
1047232503 8:123009423-123009445 CAGAATTAAATCTAGGTGCAAGG - Intergenic
1050449568 9:5765961-5765983 CTGAAGTGAACTTGGGAGGAAGG - Intronic
1052906834 9:33842487-33842509 TTGAATTAATTTTGGAGGGATGG + Intronic
1056034525 9:82589800-82589822 CAGAATTAAGTTTGGGAGGGAGG + Intergenic
1056508189 9:87277335-87277357 CTGAATTAAATGAGGGAGGGCGG + Intergenic
1056695688 9:88848995-88849017 CTGAATTATGGATGGGTGGATGG + Intergenic
1061379437 9:130245107-130245129 GTAAATTAAATTTGGGGCGAAGG + Intergenic
1187988684 X:24845417-24845439 CTGAATTATATGTGATTGGATGG + Intronic
1190828652 X:54041707-54041729 CTTAATTCAATTTAGTTGGATGG + Intronic
1192204160 X:69085229-69085251 CTGAAGAAAATTGGGGTGGAAGG + Intergenic
1192708845 X:73558410-73558432 CTGAATTAATTTTTTGTGTATGG - Intergenic
1196143071 X:112286659-112286681 CTGACTTGAAATTGGATGGATGG - Intergenic
1197140374 X:123111202-123111224 CCGTATTATATTTGGGTGGTTGG - Intergenic
1199474872 X:148233826-148233848 ATGAATTAGATGTGGGGGGAGGG - Intergenic